We narrowed to 893 results for: gcat
-
Plasmid#59385PurposeTemplate plasmid for amplification of a selection cassette that includes two transcription terminator elements, an I-SceI site and a modified chloramphenicol resistance gene.DepositorInsertTT-ISceI-cat2
UseTemplateMutationThe 3’-end of the chloramphenicol resistance gene…Available SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Bmi1_1
Plasmid#36352DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop A
Plasmid#171779PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Val22 and Asn23DepositorInsertsfGFP-DogTag Loop A
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Val2…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL3-pegRNA-attL2
Plasmid#213052PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL3 and attL2DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa2
Plasmid#79005PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 2.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR3
Plasmid#213051PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR3DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX335-NEAT1_IS_v1
Plasmid#97085PurposeEncodes an sgRNA that creates a SSB near the poly(A) site of human NEAT1_1 isoform.DepositorInsertsgRNA NEAT1_IS_v1
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shSV40 neo
Plasmid#158646PurposeLentiviral shRNA vector targeting simian virus 40 T antigen (SV40Tag)DepositorInsertSV40Tag (SV40gp6 Simian virus 40)
UseLentiviralAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Oct4-Cr1
Plasmid#66989PurposeExpresses gRNA that targets stop codon for OCT4DepositorInsertgRNA for Crispr targeting the OCT4 stop codon
ExpressionMammalianAvailable SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
VE-cad KI gRNA1
Plasmid#92310PurposeCRISPR-GFP-gRNA for cutting VEcadDepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-GEMSgRNA2
Plasmid#204768PurposepU6-PspCas13b-gRNA-Actb1216 backbone (Addgene ID: 155368) containing guide RNA #2 targeting the GEMS m6A reporter mRNA sequence.DepositorInsertguide RNA targeting GEMS m6A sensor mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shTREX1
Plasmid#127700PurposeDoxycyclin inducible shRNA knockdown of both human and mouse TREX1 geneDepositorAvailable SinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBB75-ncRNA
Plasmid#194087PurposeExpresses Ec86 ncRNA in Escherichia coliDepositorInsertEc86 ncRNA
PromoterT7Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
ABE7.10-F148A
Plasmid#132946PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertABE7.10(F148A)
UseCRISPR; Base editorExpressionMammalianMutationABE7.10(F148A)Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-Blast
Plasmid#159741PurposeExpresses Cas9-2A-Blast and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Bmi1_3
Plasmid#36354DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only