-
Plasmid#112244PurposeEncodes the drug-preservable Cas9-NS3-NLS/VPR, which can be used to activate gene expression when combined with an NS3 inhibitor and appropriately designed sgRNA.DepositorInsertdCas9-NS3-NLS/VPR
UseTagsAU1 (N term on NS3) and HA (C term on NS3)ExpressionMammalianMutationNS3 mutant T54APromoterCMVAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgApc/Cre
Plasmid#89641PurposeExpresses an Apc-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Apc (Apc Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorInsertsCas9
Gam, Beta, Exo
I-scel
UseTagsExpressionMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArid1a/Cre
Plasmid#89642PurposeExpresses an Arid1a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arid1a (Arid1a Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm/Cre
Plasmid#89643PurposeExpresses an Atm-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atm (Atm Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT
Plasmid#187652PurposeContains HaloTag to be inserted into the NTD of Gria1 (via HITI), single guide RNA to target Cas9 to Gria1 under control of the U6 promoter, and miRFP670 under control of human synapsin promoter.DepositorInsertsHaloTag donor sequence
miRFP670
UseAAV and CRISPRTagsN/AExpressionMammalianMutationPromoterSynapsinAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBP-HRV3C-AcrIF9
Plasmid#141442PurposeExpression of AcrIF9 in E. coli, tagged with an HRV3C-cleavage fusion to Maltose Binding Protein.DepositorInsertAcrIF9
UseTagsHRV3C cleavage site and Maltose Binding ProteinExpressionBacterialMutationPromoterptacAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG422_UV5
Plasmid#165607PurposeVector for expression of the SpCas9 KG variant with sgRNA in E. coli: KG(SpCas9, D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 KG(D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationD1332K and R1333G mutations in SpCas9PromoterlacUV5 driving Cas9 KG and UV5 driving sgRNAAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgp53/Cre
Plasmid#89646PurposeExpresses a p53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting p53 (Trp53 Mouse)
UseCre/Lox and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA15
Plasmid#199587PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA16
Plasmid#199588PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA17
Plasmid#199589PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA14
Plasmid#199586PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorInsertEZH2 (Ezh2 Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG CLTX-CAR
Plasmid#157743Purposeknock CLTX-CAR into AAVS1 safe harbor locus for constitutive expressionDepositorInsertchlorotoxin containing chimeric antigen receptor targeting glioblastoma
UseCRISPR, Synthetic Biology, and TALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG CLTX-NKG2D-2B4-CD3z CAR
Plasmid#157744Purposeknock CLTX-NKG2D-2B4-CD3z CAR into AAVS1 safe harbor locus for constitutive expressionDepositorInsertchlorotoxin containing chimeric antigen receptor targeting glioblastoma
UseCRISPR, Synthetic Biology, and TALENTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pM-Cas9
Plasmid#196325Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding SpCas9 in place of viral GPDepositorInsertFull length TSWV M antigenome encoding SpCas9 in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pM-ABE
Plasmid#196292Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding ABE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding ABE in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable sinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-VPH
Plasmid#120556PurposeEncode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to 2 tandem ERT2, VP64, P65 and HSF1DepositorInsertscFvGCN4, GB1, ERT2, VP64, P65 and HSF1
UseLentiviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
ScFv-2ERT2-V
Plasmid#120553Purpose3rd gen transfer vector. Encode an antibody that binds to the GCN4 peptide from the SunTag system, and is fused to sfGFP, 2 tandem ERT2 and VP64.DepositorInsertscFvGCN4, sfGFP, GB1, ERT2, VP64
UseLentiviralTagsExpressionMammalianMutationPromoterhPGKAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only