60,522 results
-
Plasmid#121532Purposeexpression of PYL-SfGFP-Emerin, lentivirus vectorDepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA Set9 wt
Plasmid#24084DepositorAvailable SinceOct. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
Lenti-UbC-LARGE1-EF1a-BSD
Plasmid#205151PurposeExpress UbC-driven LARGE1 and EF-1a driven BSDDepositorInsertLARGE xylosyl- and glucuronyltransferase 1 (LARGE1 Human)
UseLentiviralExpressionMammalianPromoterUbCAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
SPLICS Po-ER Long P2A
Plasmid#164113PurposeDetect the long Peroxisomes-Endoplasmic reticulum contactDepositorInsertSplit YFP Po-ER Long P2A
ExpressionMammalianAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hMC4R
Plasmid#179315PurposeExpress human melanocortin 4 receptor (GFP tagged) in mammalian cellsDepositorAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-BCR-ABL-p210-FLAG
Plasmid#205619PurposeExpression of BCR-ABL oncogene in mammalian cellsDepositorInsertBCR-ABL oncogene, p210 isoform b3a2
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-PGK-PYL1-sfGFP-Coilin
Plasmid#122177Purposeexpression of PYL1-SfGFP-Coilin, lentivirus vectorDepositorAvailable SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-CCR5
Plasmid#98950PurposeMammalian expression plasmid for N-terminal HA-tagged human CCR5DepositorInsertCCR5 (CCR5 Human)
TagsHA (YPYDVPDYA) epitope tag and Signal/leader sequ…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SUV39H1_WT
Plasmid#82236PurposeGateway Donor vector containing SUV39H1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
p403-BrdU-Inc
Plasmid#71789PurposeBrdU-incorporating plasmid with selectable marker HIS3DepositorAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF1062
Plasmid#143751PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMVβ-p300.DY-myc
Plasmid#30490DepositorInsertp300 (EP300 Human)
TagsMycExpressionMammalianMutationaspartic acid 1399 converted to tyrosine (Acetyla…Available SinceOct. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF0630
Plasmid#142668PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
HRH2-Tango
Plasmid#66401PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
BCL6-GFP in Artichoke
Plasmid#169931PurposeOverexpression of Full Length of BCL6-GFP fusionDepositorAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Geminin-mStrawberry reporter
Plasmid#158690PurposeThis plasmid is a Geminin cell cycle reporter. It has CMV promoter driving the expression of Geminin fused to mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
H2B-Venus
Plasmid#20971DepositorAvailable SinceMay 7, 2009AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-151a-3p
Plasmid#103258PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-151a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-151a-3p target (MIR151A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-32a(+)-TGFB1m
Plasmid#120286PurposeProduce human recombinant mTGFB1 in DE3 cellsDepositorInsertmonomeric Transforming Growth Factor-β1
Tags6x His and S-TagExpressionBacterialMutationCodon optimized for E. Coli productionPromoterT7 PromotorAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only