We narrowed to 10,546 results for: Uty
-
Plasmid#230932PurposeUsed for producing AAV-CMV-eGFP viruses with the AAVtri triple-plasmid system. This system combines the use of the mini-pHelper-1.0 and AAV helper plasmids carrying different AAV serotypes.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4A
Plasmid#224448PurposeRep/Cap plasmid for the production of MyoAAV 4A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYNSL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W
Plasmid#67980PurposeCas9 activity reporter with BFP and GFP.DepositorInsertU6gRNA cassette, PGKBFP2AGFP cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gGFP)-PGKmCherry2AGFP-W
Plasmid#67982PurposeCas9 activity reporter with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6a
Plasmid#207851PurposeMammalian expression of PE6a prime editorDepositorInsertPE6a
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationEc48rt(E60K, K87E, E165D, D243N, R267I, E279K, K3…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Archon2-KGC-GFP-ER2-WPRE
Plasmid#108424PurposeArchon2 fluorescent voltage reporter in mammalian expression plasmidDepositorInsertArchon2-KGC-EGFP-ER2
ExpressionMammalianPromoterCAGAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-EGFP
Plasmid#108417PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-EGFP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-ERK2-L4A-MEK1_fusion
Plasmid#39197DepositorTagsMycExpressionMammalianMutationL4A = L33A, L37A, L40A, L42APromoterCMVAvailable SinceJuly 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-NES-FRCaMPi-P2A-mGreenLantern
Plasmid#232841PurposeAAV transfer plasmid for CAG-mediated co-expression of FRCaMPi and mGreenLanternDepositorInsertNES-FRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterCAGAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-EF1a-Archon1-KGC-EGFP-ER2
Plasmid#108425PurposeLentivirus production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-KGC-EGFP-ER2
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Archon1-KGC-EGFP-ER2-WPRE
Plasmid#108423PurposeArchon1 fluorescent voltage reporter in mammalian expression plasmidDepositorInsertArchon1-KGC-EGFP-ER2
ExpressionMammalianPromoterCAGAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSSRB069_pAC8-hsDDB1dB
Plasmid#218790PurposeInsect cell expression vector for 6xHis-TEV-hsDDB1∆BDepositorInsertDNA damage-binding protein 1 (DDB1 Human)
Tags6xHis-TEVExpressionInsectMutationDeleted amino acids 396-705 and replaced with GNG…PromoterpolyhedrinAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE6d-dualU6-Dnmt1-PE3-loxP
Plasmid#207863PurposeAAV genome encoding C-terminal PE6d and U6 expression cassettes for Dnmt1 PE3 pegRNA and ngRNADepositorInsertNpuC-Cterm-PE6d-dualU6-Dnmt1-PE3-loxP
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE6d-dualU6-Rosa26-twinPE-attB
Plasmid#207860PurposeAAV genome encoding C-terminal PE6d and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PE6d-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-NES-SomaFRCaMPi
Plasmid#232836PurposeAAV transfer plasmid for CAG-mediated Cre-dependent expression of soma-targeted FRCaMPiDepositorInsertNES-FRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterCAGAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1A
Plasmid#224437PurposeRep/Cap plasmid for the production of MyoAAV 1A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDLTTP insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUSE2ss-CLIg-mK_M18
Plasmid#82358PurposeExpression plasmid coding for kappa light chain of mouse antibody specific to antigen B of the ABO blood group system, clone M18.DepositorInsertTagsnoneExpressionMammalianPromoterhEF1-HTLV promAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4E
Plasmid#224452PurposeRep/Cap plasmid for the production of MyoAAV 4E, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDFNNT insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only