We narrowed to 2,555 results for: BFP
-
Plasmid#58875PurposeMESA target chain with dTomato ectodomain, no linker domain, M cleavage sequence, and tTA-BFP fusionDepositorInsertMESA target chain with dTomato ectodomain, cd28 transmembrane domain, mutated TEV cleavage sequence (M in P1')
UseAAVTagsEBFPExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
CD4_LD 0_CS G_tTA-BFP
Plasmid#58869PurposeMESA target chain with CD4 ectodomain, no linker domain, G cleavage sequence, and tTA-BFP fusionDepositorInsertMESA target chain with CD4 ectodomain, cd28 transmembrane domain, wild type TEV cleavage sequence
UseAAVTagsEBFPExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNIL
Plasmid#172113PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into lower motor neurons via NGN2, ISL1, and LHX3 expressionTagsT2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac dCas9-VPR
Plasmid#191269PurposepiggyBac integration and dox-inducible expression of VPR-dCas9-HA-tagBFPDepositorInsertsVPR-dCas9-HA-tagBFP
rtTA3-IRES-PURO
UseCRISPRTagsHA and tagBFPExpressionMammalianAvailable SinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-FL-TagBFP
Plasmid#120921PurposeExpresses BFP tagged Ptch1DepositorAvailable SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac dCas9-KRAB
Plasmid#191314PurposepiggyBac integration and dox-inducible expression of KRAB-dCas9-HA-tagBFPDepositorInsertsKRAB-dCas9-HA-tagBFP
rtTA3-IRES-PURO
UseCRISPRTagsHA and tagBFPExpressionMammalianAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_ABE8e-SpRY-P2A-BFP_HygroR
Plasmid#213009PurposeA lentiviral vector used to create stable cell lines expressing the ABE8e-SpRY base editor and BFPDepositorInsertABE8e-SpRY-D10A
UseCRISPR and LentiviralExpressionMammalianMutationD10A nickase variant of SpRYPromoterEf-1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
attB53_SNCB+_attB53
Plasmid#183614PurposeRMCE vector to shuttle puromycin resistance, anti-GFP SynNotch receptor, tagBFP and TRE-mCherry cassettes into attP50-flanked landing pad (Addgene 183609). All cassettes on sense (+) strand.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNAEmptyVector_Puro_T2A_BFP2
Plasmid#236729PurposeDual sgRNA empty vector expressing BFP with Puromycin selectionDepositorTypeEmpty backboneUseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_Puro_T2A_BFP2
Plasmid#236730PurposeDual sgRNA targeting CTRL expressing BFP with Puromycin selectionDepositorInsertNegative CTRL
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
aTY65_pTRE_Wnt3a_IRES_tagBFP2_WPRE
Plasmid#225349PurposeLentiviral vector for Wnt3a and BFP expressionDepositorAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-MYOD1-shOct4
Plasmid#182309PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into skeletal muscle cells via MYOD1 and shOCT4 expressionInsertsTagsT2A-mycNLS-mTagBFP2ExpressionMammalianMutationshOct4PromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
attB-puro donor.dna
Plasmid#181923PurposeattB-puro DNA donor for twinPE and Bxb1 mediated gene-size insertionDepositorInsertattB-EGFP-EF1α-PuroR-T2A-TagBFP
ExpressionMammalianAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
SStart-36xMashTag-BFP-3xStop-24xPP7 (Sunstart-MashTag reporter)
Plasmid#128608PurposeExpresses 36xMashTag with SunTag frame as mainframe, followed by BFP linker and 24 repeats of PP7 hairpins in 3’ UTR.DepositorInsert36xMashTag
ExpressionMammalianPromoterPcmvAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pATZ-BFP-HA-GFP11
Plasmid#177721PurposeER protein alpha-1-antitrypsin containing E342K mutation (ATZ mutant) fused to blue fluorescence protein (BFP) tag protein, an HA tag and the eleventh β-strand of GFPDepositorInsertalpha-1-antitrypsin (SERPINA1 Human)
TagsGFP11, HA, and TagBFPExpressionBacterial and MammalianMutationE342K (ATZ mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry_LD 0_CS A_tTA-BFP
Plasmid#58873PurposeMESA target chain with mCherry ectodomain, no linker domain, A cleavage sequence, and tTA-BFP fusionDepositorInsertMESA target chain with mCherry ectodomain, cd28 transmembrane domain, mutated TEV cleavage sequence (A in P1')
UseAAVTagsEBFPExpressionMammalianPromoterCMVAvailable SinceNov. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
EK0396 BFPmut-stop-t70587 (pEAQ)
Plasmid#191171PurposeEK0208 in plant-expressable format; Trigger 1 in 3' UTR of an inactive BFPDepositorInsertt70587 (plant)
ExpressionPlantMutationWTAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-h-mmPtch1-B-HA-TagBFP
Plasmid#120910PurposeExpresses BFP tagged Ptch1-BDepositorInsertPtch1 (Ptch1 Mouse)
TagsHA and TagBFPExpressionMammalianMutationdeleted amino acids 620-643, truncated at 1291PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only