We narrowed to 6,639 results for: itch
-
Plasmid#153545Purposethis is the non-clustering version of LIC-Z tagged with mcherryDepositorInserthuman TCR ζ-Chain (CD247 Human)
TagsmCherryExpressionMammalianMutationwith Cry2 sequence deleted from LIC-ZPromoterCMVAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRY-GalVP16 (B695)
Plasmid#92031PurposeExpresses CRY2 (full length, intact NLS) fusion with Gal4DBD(aa1-147) fused to VP16AD (truncated), downstream of mCherry-IRES.DepositorAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Kif5A-GFP-CIBN
Plasmid#102252PurposeExpresses fusion of kinesin heavy chain 5A (1-572) with GFP and CIB1 (1-170)DepositorAvailable SinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRY2-mCherry-Miro1TM
Plasmid#102247PurposeExpresses fusion of CRY2PHR with mCherry and transmembrane domain of Miro1DepositorAvailable SinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-FIRE-pHLy
Plasmid#170774PurposeRatiometric biosensor expressed with UbC promoter for probing lysosomal pH in mammalian cellsDepositorInsertLAMP1 (LAMP1 Human)
UseLentiviralTagsmCherry and mTFP1ExpressionMammalianMutation84 nucleotide Signal Sequence switched to the beg…PromoterhUbCAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FIRE-pHLy
Plasmid#170775PurposeRatiometric biosensor expressed with CMV promoter for probing lysosomal pH in mammalian cellsDepositorInsertLAMP1 (LAMP1 Human)
UseLentiviralTagsmCherry and mTFP1ExpressionMammalianMutation84 nucleotide Signal Sequence switched to the beg…PromoterCMVAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-FUSN-mCh-Cry2WT
Plasmid#101223PurposeFUS(1-214) fused to mCh-Cry2WTDepositorAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-FUSN-mCh-Cry2olig
Plasmid#101224PurposeFUS(1-214) fused to mCh-Cry2oligDepositorInsertFUS(aa1-214) (FUS Human)
UseLentiviralTagsmCherry-Cry2oligExpressionMammalianPromoterSFFVAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
iCas
Plasmid#84232PurposeExpression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT)DepositorInsertCas9
Tags2A-OFP co-expression and ERT2-ERT2ExpressionMammalianPromoterCMVAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-mCherry-PA-Rac1
Plasmid#22027PurposeExpression of photoactivatable Rac1DepositorInsertPA-Rac1 (RAC1 Human, Avena sativa (oat))
Tags6xHis and mCherryExpressionBacterial, Insect, and Mamm…MutationLOV(Leu404-Leu546), Rac1 starts at Ile4 and conta…PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-TM-KA2-CaM-NES-TevN-AsLOV2-TEVseq-tTA
Plasmid#171617PurposeAAV Soma-targeted Cal-Light with KA2DepositorInsertTM-KA2-CaM-NES-TevN-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyTagsMycExpressionMammalianPromoterCMVAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-TOMM20
Plasmid#227307PurposeDonor template for mStayGold insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mStayGold Tag (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-EYFP-hTRF2
Plasmid#103804PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhTRF2: deletion of amino acids 1-42 and 476 compa…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDragon-Ctgf
Plasmid#155015PurposeFor Flp-mediated cassette exchange. Expresses tdTomato in the presence of (r)tTA, switching to connective tissue growth factor in the presence of Cre and (r)tTA activity.DepositorAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONRp5-p2 GFP-NShroom3-iLID
Plasmid#170976PurposeN-terminal component of OptoShroom3 optogenetic tool. Binds to apical junctions. pDONRp5-p2 plasmid.DepositorInsertNShroom3 (Shroom3 Mouse)
UseGateway cloningTagseGFP and iLIDMutationFrom isoform 2, deleted amino acids 1389 - 1805,…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-NLSx3-miRFP703-dSal-p53NT(1-97)-5SD-lin-hCRY2
Plasmid#241846PurposeExpresses an improved actuator of Opto-p53 in mammalian cells.DepositorInsertp53 (TP53 Human)
TagsCRY2 and miRFP703ExpressionMammalianMutationN-terminus (1-97 aa) containing five phosphorylat…PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLPS1-iLID::EGFP::FTH1 (pBS1042)
Plasmid#185289PurposeFor the mammalian expression of the synthetic protein iLID::eGFP::FTH1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertiLID::eGFP::FTH1
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
BcLOV4 fusion tools screening plasmid #1
Plasmid#174511PurposeCloning plasmid for creating BcLOV4 optogenetic tool fusions. Expresses [BamHI]-BcLOV4-[EcoRI]-GGGSx2-mCherry-[XhoI]-STOP in a pcDNA3.1 backbone.DepositorInsert[BamHI]-BcLOV4-[EcoRI]-GGGSx2-mCherry-[XhoI]-STOP
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pROF148
Plasmid#155330PurposeBinary vector for expression of the PULSE system under the control of AtUbi10 promoter. It contains a plant selection cassette.DepositorInsertLB_Tnos-nptII-Pnos_PAtUbi10-SRDX-NLS-EL222-Tnos_PAtUbi10-E-PIF6-NLS-Tnos_PAtUbi10-PhyB-VP16-NLS-Tnos_RB
UseSynthetic BiologyExpressionPlantAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only