We narrowed to 15,073 results for: nts
-
Plasmid#91223Purposeprotoplast vector expressing gRNA23 targeting tomato ANT1 (control without TREX2 expression)DepositorInsertgRNA targeting tomato ANT1
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMP71-tCD19-LLO-SIINFEKL
Plasmid#174598Purposeexpresses the extracellular and transmembrane domain of murine CD19 with a C terminal fusion of the LLO190 and SIINFEKL epitopesDepositorInsertmembrane bound CD19, LLO antigen, SIINFEKL (ovalbumin) antigen
ExpressionMammalianAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
GalT-moxDendra2
Plasmid#89789Purposemammalian expression of GC localized moxDendra2DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
(326) pAAV SV40-ZsGreen U6-gRNA
Plasmid#163020PurposeFluorescent reporter for Sa gRNA (Bsa1 sites)DepositorInsertZs Green
UseAAVExpressionMammalianPromoterSV40Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0402
Plasmid#91009PurposeModule A, Promoter: AtUbi10, Gene: AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertAtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoterAtUbi10Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGE479
Plasmid#153270PurposeM4E shuttle vector containing the Solanum lycopersicum U3 promoter for preparation of single guide RNA transcriptional units by cloning of hybridized oligonucleotides.DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDGE331
Plasmid#153240PurposeM1E shuttle vector containing the Arabidopsis thaliana U6 promoter for preparation of single guide RNA transcriptional units by cloning of hybridized oligonucleotides.DepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_attR1-ORF-attR2-NTEV-TCS-GV-2xHA_DEST
Plasmid#194385PurposeGateway Destination vector for split TEV assaysDepositorInsertattR1-ORF-attR2-NTEV-TCS-GV-2xHA
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-SpCas9-HF1
Plasmid#126770PurposeExpression of increased fidelity SpCas9-HF1 in bacterial cellsDepositorInsertSpCas9-HF1
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationN497A, R661A, Q695A, Q926APromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pb459-mU6-sgRNA-EF1a-PuroR
Plasmid#195507Purposepiggybac vector expressing non-targeting control sgRNA cloned using BlpI and BstXI sitesDepositorInsertPuromycin
UseCRISPR; PiggybacExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-ERK2 L198A L232A
Plasmid#8978DepositorAvailable SinceNov. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pBabe-PI(WT)-Src(KD)-mCherry
Plasmid#87358PurposePI(WT): Photo-inhibitable/blue light sensitive; kinase dead Src mutationDepositorInsertsTagsmCherryExpressionBacterial and MammalianMutationD388RPromoterCMVAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCA15-Ubc-NLS- scFV-tdTomato
Plasmid#199446PurposeExpression of scFV-tdTomato that binds to the GCN4 peptide from the SunTag System in mammalian cellsDepositorInsertscFV-tdTomato
UseLentiviralExpressionMammalianPromoterhuman ubiquitin C (UBC)Available SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFAB815
Plasmid#47854PurposeBIOFAB reporter plasmid for measuring rnpB T1 termination efficiencyDepositorInsertrnpB T1 terminator
UseSynthetic BiologyExpressionBacterialPromoterpLTetO9Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGWB529
Plasmid#74871PurposeGateway cloning compatible binary vector for C-terminal fusion with TAP (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGWB524
Plasmid#74866PurposeGateway cloning compatible binary vector for N-terminal fusion with GST (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRcCMV Rootletin (Nigg pFL6(CW501))
Plasmid#41167DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only