We narrowed to 23,913 results for: promoter
-
Plasmid#114312PurposeTissue-specific expression of the GFP living color under the control of the Keratin7 promoterDepositorInsertGFP
UseLentiviralAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAdx-CMV-YFP
Plasmid#73348PurposeExpress YFP-NLS under CMV promoterDepositorInsertCMV-YFP
UseAdenoviralPromoterCMVAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6_AluJb
Plasmid#240314PurposeOverexpress the consensus AluJb retrotransposon sequence from a Pol-III promoterDepositorInsertAluJB
ExpressionMammalianPromoterU6Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
N1199 launching
Plasmid#160386PurposeExpression of N1199 narnavirus ORF under PGK1 promoter with a 3' HDV ribozyme sequenceDepositorInsertN1199
ExpressionYeastPromoterPGK1Available SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pCMV-AcGFP
Plasmid#131008PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a CMV promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpCMV and pTRE3G-BiAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pGFAP-AcGFP
Plasmid#133733PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a GFAP promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpGFAP and pTRE3G-BiAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/Myc-DNMT1
Plasmid#36939PurposeMammalian expression of human DNMT1 with myc tagDepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJR98
Plasmid#187239PurposeCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sitesDepositorInsertCR3 constant region - hU6 sgRNA promoter flanked by BsmBI sites
ExpressionBacterialAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags3XFLAG-Cas9ExpressionMammalianPromoterCBh; U6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA2-DDB1
Plasmid#19909DepositorInsertDamage-specific DNA binding protein 1 (DDB1 Human)
TagsHAExpressionMammalianMutationplease see depositor comment belowAvailable SinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLX307 P2A GFP Luciferase
Plasmid#193674PurposeConstitutive lentiviral expression of LuciferaseDepositorInsertLuciferase
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
5HRE/GFP
Plasmid#46926Purposehypoxia-responsive enhanced green fluorescent protein (EGFP)-based systemDepositorInsert5X HRE of VEGF (VEGFA Human)
Tagsd2EGFPExpressionMammalianMutationfive copies of a 35-bp fragment from the hypoxia-…PromoterEF-1α promoterAvailable SinceAug. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFC902
Plasmid#106904PurposeThe vector has a U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA-Gly repeat; and a gene encoding cas9 controlled by Ptef1 and Ttef1DepositorInsertscas9
pyrG
U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-Pol2-ffLuc2-eGFP
Plasmid#71394PurposeLentiviral vector of luciferase-eGFP fusion gene driven by Pol2 promoterDepositorInsertPol2-ffLuc2-eGFP
UseLentiviralExpressionMammalianPromoterPol2 (mouse RNA polymerase II gene promtoer)Available SinceDec. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE_puro
Plasmid#118692PurposeEmpty vector to express overexpression cDNADepositorTypeEmpty backboneUseLentiviralPromoterCMVAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-GFP-αTAT1
Plasmid#27099DepositorInsertα-Tubulin K40 acetyltransferase1 (ATAT1 Human)
TagsGFP, S-tag, and TEV siteExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.3 GCN1-3xFlag_IRES-iRFP
Plasmid#198388PurposeGCN1 expressionDepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_mScarlet_CLASP_RGS2membrane
Plasmid#133086PurposePlasmid contains mScarlet with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-mScarlet-yeLANS). CLASP modulates nuclear localization of mScarlet in response to blDepositorInsertmScarlet-CLASP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pM-ABE
Plasmid#196292Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding ABE in place of viral GPDepositorInsertFull length TSWV M antigenome encoding ABE in place of viral GP
UseCRISPRTags3×flagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only