We narrowed to 26,950 results for: gfp
-
Plasmid#110190PurposeExpression of mouse MeCP2 (deltaNC) in mammalian cellsDepositorInsertMeCP2_e2 delta NC (mouse cDNA) - EGFP (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationdelta N and C terminiPromoterCMVAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACE2v2-sfGFP
Plasmid#145173PurposeMammalian expression plasmid for sACE2-sfGFP high affinity variant 2DepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsLinker GSGGSGSGG and superfolder GFPExpressionMammalianMutationExtracellular, soluble protease domain (a.a. M1-D…PromoterCMVAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIRESN2 GFP-uvr8at
Plasmid#44969DepositorInsertGFP-UVR8 (UVR8 Synthetic, Mustard Weed)
TagsGFPExpressionMammalianMutationdeleted Methionine 1PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSCALPS-mAgo2-EGFP
Plasmid#209935PurposeLentiviral expression of mouse Argonaute-2 in mammalian cellsDepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-T7-hAIM2-EGFP
Plasmid#51608PurposeExpress T7 and GFP-tagged hAIM2 in mammalian cellsDepositorAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRS406 ATG9 stopGFP
Plasmid#114669PurposeExpresses yeast ATG9 under the endogenous promoter with a stop codon introduced before GFP C-terminal tagDepositorInsertATG9
TagsGFPExpressionYeastMutationChanged the three linker base pairs after the las…PromoterATG9Available SinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pfNL43-dGPE-EGFP
Plasmid#36866DepositorInsertNL43-dGPE-EGFP
UseLentiviral and RetroviralExpressionMammalianMutationparts of Gag and Pol were deleted and EGFP insert…Available SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNS19-LV-mutRFP-2A-GFP
Plasmid#113716PurposeLentiviral vector for fluorescent reporter system: expresses a green fluorescent protein that is preceded by an inactive version of a red fluorescent protein (2 ntd substitution at the fluorophore)DepositorInsertmutRFP-2A-GFP-IRES-Puro
UseLentiviral; Reporter systemExpressionMammalianMutationY64L (mutRFP)Available SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-BAP1-D672G-GFP
Plasmid#78919PurposeMammalian expression of BAP1 with D672G and an EGFP fusionDepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-EGFP-BarcodeV1
Plasmid#78633PurposeGESTALT V1 integrating barcode with Puro and EGFPDepositorInsertGESTALT target V1
UseLentiviralAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
FCK-Chronos-GFP
Plasmid#80902PurposeLenti-mediated expression of Chronos-GFP under the CaMKII promoter.DepositorInsertChronos-GFP
UseLentiviralTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceMarch 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD EGFP
Plasmid#187267PurposeLentiviral expression of shRNA targeting CortactinDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-83:EZH2-mEGFP
Plasmid#164499PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human EZH2DepositorInsertEZH2 Homology Arms with mEGFP-linker (EZH2 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceFeb. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRK5-mEGFP-FOXF1-WT
Plasmid#194568PurposeMammalian Expression of mEGFP-FOXF1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 NCD
Plasmid#124927PurposeFor expression of NCD (a.a. 1-139) of SIN1-GFPDepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNIR-FbGFPY58/C-JIP
Plasmid#184684PurposeNIR-Fb-based JNK inhibitorDepositorInsertNIR-FbGFPY58/C-JIP
ExpressionMammalianPromoterCMVAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRecLV103-GFP-PGBD5
Plasmid#65409PurposeLentiviral expression vector for fusion of GFP with human PGBD5DepositorAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
NGL-1-myc/pEGFP-N1
Plasmid#197314PurposePlasmid expressing an antigen targeting Neuroligin-1DepositorInsertNeuroligin-1 (Nlgn1 Rat)
ExpressionMammalianAvailable SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only