We narrowed to 10,928 results for: cat.1
-
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only
-
SG3ΔENV CA E45A
Plasmid#145783PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and E45A mutation in capsid (CA E45A).DepositorInsertCapsid
UseLentiviral and RetroviralExpressionMammalianMutationChanged Capsid residue glutamic acid 45 to alanin…Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA M66I
Plasmid#149687PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and M66I mutation in capsid (CA M66I).DepositorInsertCapsid
UseLentiviral and RetroviralExpressionMammalianMutationChanged Capsid residue Met 66 to Iso (CA M66I)Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
p36-p37-p38-p40-pET-Duet-1-Rfc3-T76D
Plasmid#175051PurposeOverexpression of human Rfc2,Rfc3-3KtoA,Rfc4,Rfc5 in E.coliDepositorExpressionBacterialMutationchanged Thr76 to Asp, phosphomimetic mutationPromoterT7 promoterAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
p36-p37-p38-p40-pET-Duet-1-Rfc3-3KtoA
Plasmid#175050PurposeOverexpression of human Rfc2,Rfc3-3KtoA,Rfc4,Rfc5 in E.coliDepositorExpressionBacterialPromoterT7 promoterAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-Dual_BNIP3(1-158aa)-THROMBIN-GST (W18A/L21A; deltaLIR)
Plasmid#223778PurposeExpression of recombinant protein for purificationDepositorInsertBNIP3 soluble part (BNIP3 Human)
TagsThrombin cleavage-GSTExpressionInsectMutationW18A/L21A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST (I224A/L227A; deltaLIR3)
Plasmid#223775PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationI224A/L227A; deletion of LIR3Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST (I307A/V310A; deltaLIR4)
Plasmid#223776PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationI307A/V310A; deletion of LIR4Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST (Y213A/I216A; deltaLIR2)
Plasmid#223783PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationY213A/I216A; deletion of LIR2Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_BCL2L13(1-465aa)-EGFP-TEV-GST (W276A/I279A; deltaLIR1)
Plasmid#223746PurposeExpression of recombinant protein for purificationDepositorInsertBCL2L13 soluble part (BCL2L13 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationW276A/I279A; deletion of LIR1Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_NIX(1-182aa)-EGFP-TEV-GST (W36A/L39A; deltaLIR)
Plasmid#223748PurposeExpression of recombinant protein for purificationDepositorInsertNIX (BNIP3L) soluble part (BNIP3L Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationW36A/L39A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_FUNDC1(1-50aa)-EGFP-TEV-GST (Y18A/L21A; deltaLIR)
Plasmid#223750PurposeExpression of recombinant protein for purificationDepositorInsertFUNDC1 soluble part (FUNDC1 Human)
TagsEGFP-TEV-GSTExpressionBacterialMutationexpresses aa 1-50, with Y18A/L21A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)(2) sites mutant pGL3Basic
Plasmid#32734DepositorInsertCCND1 promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) - CTTTGATCTTTGCT deleti…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)-(3) sites mutant pGL3Basic
Plasmid#32735DepositorInsertCCND1 Promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) CTTTGATCTTTGCT deletion…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
-962 human cyclin D1 promoter TCF (1)-(4) sites mutant pGL3Basic
Plasmid#32736DepositorInsertCCND1 Promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) CTTTGATCTTTGCT deletion…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET3a-FruK
Plasmid#186256PurposeOverexpression of FruK for purificationDepositorAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75234PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (1/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV RT D185A
Plasmid#145782PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and D185A mutation in reverse transcriptase (RT D185A).DepositorInsertReverse Transcriptase
UseLentiviral and RetroviralExpressionMammalianMutationChanged Reverse Transcriptase Aspartic Acid 185 t…Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlc_N + pSiMPlc_C
Plasmid#134312PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertcmR_gp41-1 N-intein + cmR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA E28A,E29A
Plasmid#145785PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and E28A,E29A mutation in capsid (CA E28A,E29A).DepositorInsertCapsid
UseLentiviral and RetroviralExpressionMammalianMutationChanged Capsid residues Glutamic Acid residues 28…Available SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA Q63A,Q67A
Plasmid#145784PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and Q63A,Q67A mutation in capsid (CA Q63A,Q67A).DepositorInsertCapsid
UseLentiviral and RetroviralExpressionMammalianMutationChanged Capsid residues Glutamines 63 and 67 to a…Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75238PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc1 (1/2)DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75242PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (1/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA Q67H/N74D
Plasmid#217442PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and Q67H/N74D mutations in capsid (CA Q67H/N74D).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/UbC/mSlc7a1
Plasmid#17224DepositorAvailable SinceFeb. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA
Plasmid#99698PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA with BsaI cloning sites for programming, vector allows for strong activation of programmed target gene, can be packaged and delivered as AAVDepositorTypeEmpty backboneUseAAVAvailable SinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSiMPls_N + pSiMPls_C
Plasmid#167203PurposeSiMPl plasmid pair (pSiMPls) for use with spectinomycin/streptomycinDepositorInsertsEGFP
SmR 1-75 + gp41-1 N-intein
mRuby3
gp41-1 C-intein + SmR 76-263
ExpressionBacterialPromoterAmpR, CAT, pBAD, and pTrcAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
FUW-crRNA-1-U6_TRE-dLbCpf1-NLS-hCTCF_K365A_R368A-HA-P2A-tagBFP
Plasmid#194890PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-K365A_R368A mutant and crRNA-1 targeting the human MECP2 locus.DepositorInsertsdLbCpf1-NLS-hCTCF_K365A_R368A
U6-crRNA1
UseLentiviralTagsHAMutationHuman codon optimized catalytically inactive LbCp…PromoterTRE and U6Available SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-crRNA-1-U6_TRE-dLbCpf1-NLS-hCTCF_WT-HA-P2A-tagBFP
Plasmid#194889PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-WT and crRNA-1 targeting the human MECP2 locus.DepositorInsertsdLbCpf1-NLS-hCTCF_WT
U6-crRNA1
UseLentiviralTagsHAExpressionMammalianMutationHuman codon optimized catalytically inactive LbCp…PromoterTRE and U6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-crRNA-1-U6_TRE-dLbCpf1-NLS-hCTCF_Q418A-HA-P2A-tagBFP
Plasmid#194891PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-Q418A mutant and crRNA-1 targeting the human MECP2 locus.DepositorInsertsdLbCpf1-NLS-hCTCF_Q418A
U6-crRNA1
UseLentiviralTagsHAExpressionMammalianMutationHuman codon optimized catalytically inactive LbCp…PromoterTRE and U6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NKX2-1_DelNTerm_160-371AA
Plasmid#221475PurposeGateway cloning of NKX2-1 N-terminal truncation mutation overexpressionDepositorInsertNKX2-1 (NKX2-1 Human)
UseGateway donor vectorMutationDeletion of 1-159AA N-terminal domainAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-EF1a_NKX2-1_DelNTerm_160-371AA
Plasmid#221487PurposeNKX2-1 N-terminal truncation mutation lentiviral overexpressionDepositorInsertNKX2-1 (NKX2-1 Human)
UseLentiviralTagsV5ExpressionMammalianMutationDeletion of 1-159AA N-terminal domainPromoterEF1aAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-Dual_BNIP3(1-158aa)-EGFP-TEV-GST (W18A/L21A; deltaLIR)
Plasmid#223766PurposeExpression of recombinant protein for purificationDepositorInsertBNIP3 soluble part (BNIP3 Human)
TagsEGFP-TEV-GSTExpressionInsectMutationW18A/L21A; deletion of LIRAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NKX2-1_HD_160-223AA
Plasmid#221477PurposeGateway cloning of NKX2-1 N-terminal and C-terminal truncation (homeodomain only) mutation overexpressionDepositorInsertNKX2-1 (NKX2-1 Human)
UseGateway donor vectorMutationDeletion of 1-159AA N-terminal and 224-371AA C-te…Available SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLPR2
Plasmid#209980PurposeContains Level 0 Part: resistance cassette (cat) for the construction of Level 1 plasmidsDepositorInsertresistance cassette (cat)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pETDuet1_NIX(1-182aa)-THROMBIN-GST (E72A/L75A/D77A/E81A; deltaWIPI2)
Plasmid#223753PurposeExpression of recombinant protein for purificationDepositorInsertNIX (BNIP3L) soluble part (BNIP3L Human)
TagsThrombin cleavage-GSTExpressionBacterialMutationexpresses aa 1-182, with E72A/L75A/D77A/E81A; del…Available SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX-EF1a_NKX2-1_HD_160-223AA
Plasmid#221489PurposeNKX2-1 N-terminal and C-terminal truncation (homeodomain only) mutation lentiviral overexpressionDepositorInsertNKX2-1 (NKX2-1 Human)
UseLentiviralTagsV5ExpressionMammalianMutationDeletion of 1-159AA N-terminal and 224-371AA C-te…PromoterEF1aAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MA-VN
Plasmid#123283PurposeMammalian expression plasmid for matrix domain of HIV-1 Gag fused to the N-terminal half of split fluorescent Venus (VN)DepositorInsertMatrix
TagsVN: N-terminus of split Venus (a.a. V1–A154) I152…ExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only