We narrowed to 16,668 results for: puromycin
-
Plasmid#173700PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-canisEgf
Plasmid#173845PurposeEncoding dog Egf.DepositorInsertA cDNA of canis EGF.
ExpressionMammalianMutationR1127Q- please see dep. commentsAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-N-Myc-Flag-BirA-hPOT1-DeltaOB
Plasmid#166410Purposeexpress BirA-hPOT1 ΔOB in mammalian cellsDepositorAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim-DC2-H2B2-Venus
Plasmid#129556PurposepClimDC-H2B:mV nuclear markerDepositorInsertHistone 2B fused to venus
ExpressionBacterialAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_stgRNA-Puro
Plasmid#164124PurposeBackbone for lentiviral stgRNA library construction (library 1 and 2)DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
GSX2-P2A-tGFP-DTA
Plasmid#161750PurposetGFP plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertturboGFP
UseCRISPRTagsP2A-tGFPExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shSpc25
Plasmid#160960PurposeSpc25 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shNuf2
Plasmid#160961PurposeNuf2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Puro shRNA INPP5E KD2
Plasmid#162005PurposeINPP5E shRNADepositorInsertINPP5E (INPP5E Canis Lupus)
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A LaG17-SynNotch 204TAA 442TAG
Plasmid#154778Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and LaG17-SynNotch 204TAA 277TAG, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertLaG17-SynNotch
TagsLaG17ExpressionMammalianMutation204TAA 442TAG in LaG17-SynNotch, hybrid PylT with…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.DIS3L2-3
Plasmid#128764PurposeExpresses DIS3L2 gRNA for CRISPRiDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.DIS3L2-2
Plasmid#128763PurposeExpresses DIS3L2 gRNA for CRISPRiDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.DIS3L2-1
Plasmid#128762PurposeExpresses DIS3L2 gRNA for CRISPRiDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-A39T
Plasmid#129752PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-P15L
Plasmid#129753PurposeGene targeting in marmoset cellsDepositorAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-SUV39h1 ts3
Plasmid#115882PurposeSUV39h1 knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only