We narrowed to 11,499 results for: aga
-
Plasmid#65391PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only
-
Fucci(CA) hCdt1-iRFP hGeminin-TagBFP2
Plasmid#190181PurposeFluorescent reporter vector to visualize all of cell cycle phases.DepositorInsertsExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-EV-Hygro
Plasmid#253791PurposepLenti lentiviral expression vector encoding empty vector under a human PGK promoter.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 FLAG-YAP1-TEAD-P-H2B-mCherry
Plasmid#128327PurposeReporter to evaluate YAP1/TEAD-mediated gene transcriptionDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG SARS-CoV2 RdRp.co
Plasmid#154008PurposeExpression of codon-optimized SARS-CoV2 Nsp12 (RdRp) in mammalian cellsDepositorInsertCodon-optimized SARS-CoV2 Nsp12 from ORF1ab (ORF1ab Synthetic)
Tags3xFLAG tagExpressionMammalianPromoterCMVAvailable SinceJune 23, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB-CAG-mRuby3-Gal8-P2A-Zeo
Plasmid#150815PurposeMammalian expression of mRuby3-Galectin8 (Gal8) fusion proteinDepositorInsertmRuby3-Gal8-P2A-Zeo (LGALS8 Synthetic, Human)
TagsGal8 is fused to the c-terminus of mRuby3ExpressionMammalianPromoterCAGAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-DEST-IRES-Hygro
Plasmid#253775PurposeThird generation lentiviral expression Gateway cloning destination vector under a human UbC promoter for expression of a gene of interest linked to hygromycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRSET-iGluSnFR4f
Plasmid#234444PurposeBacterial expression of glutamate sensor with with improved sensitivity and fast deactivation kinetics (4f = fast)DepositorInsertiGluSnFR4f
Tags6xHis-Xpress epiExpressionBacterialPromoterT7Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPos-Ma-CmR-TAG111
Plasmid#197571PurposePositive selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses TAG-codon interrupted chloramphenicol resistance cassette and M. alvus Pyl-tRNA(6). p15a oriDepositorInsertsChloramphenicol resistance gene - 111TAG
T7 polymerase -TAG
GFPuv
M. alvus Pyl-tRNA(6)
ExpressionBacterialMutation111TAG and 8TAG/112TAGPromoterAraC, T7, cat promoter (constitutive), and lpp (c…Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-DEST-IRES-Neo
Plasmid#253766PurposeThird generation lentiviral expression Gateway cloning destination vector under a human EF1alpha promoter for expression of a gene of interest linked to neomycin selection by an IRES.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-FBXL5-SKP1
Plasmid#226620PurposeCo-expression of FBXL5-SKP1 complex in E.coliDepositorTagsGB1ExpressionBacterialMutationAmino acids 1-198 was deleted, and 420-596 was re…PromoterT7Available SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300 (D1399Y)
Plasmid#191763PurposeExpression of EGFP fused to catalytically dead core p300 histone acetyltransferase (D1399Y)DepositorInsertFRB-EGFP-p300 core (D1399Y) (EP300 Human)
TagsEGFP (N-terminal of p300 core (D1399Y)) and FRB (…ExpressionBacterial and MammalianMutationcatalytic D1399Y mutation in p300PromoterEF1alphaAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB-NLS_T2A_mCherry_U1a-EGFP trans-splicing ωRNA
Plasmid#246436PurposeExpresses R-IscB with EGFP-repairing ωRNA in mammalian cells for trans-splicing assessments.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID
mCherry
ωRNA with trans-splicing template
TagsGFP N-terminal sequence (M1 to Q95), Hemi Intron …ExpressionMammalianMutationGFP N-terminal sequence M1 to Glutamine 95 append…PromoterCMV and U1aAvailable SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5A-HA-IRES-Puro
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5AR280H-HA-IRES-Puro
Plasmid#166953PurposeLentiviral plasmid expressing HA-tagged KIF5A R280H protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCaggs-mGold2s
Plasmid#231763PurposeExpression of mGold2s in mammalian cellsDepositorInsertmGold2s
ExpressionMammalianMutationmGold2s is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterActin promoter with CMV enhancerAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pClneoMyc-LATS1
Plasmid#66851PurposeExpress Myc-tagged LATS1 in mammalian cellsDepositorInsertLATS1 (LATS1 Human)
TagsMycExpressionMammalianMutationP44L mutation in LATS1 compared to GenBank refere…PromoterCMVAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLEX-307_LgBiT
Plasmid#191211PurposeLentiviral-mediated stable expression of LgBiT for slit nanoluciferase complementation assays in mammalian cellsDepositorInsertLgBiT (large bit)
UseLentiviral and LuciferaseMutationAB030246.1 (mutated in PMID 26569370)Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only