We narrowed to 29,857 results for: REP
-
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-stop-mut-miR-375-mutA-E
Plasmid#53714PurposeLuciferase reporter assay for CIP2A with mutated firefly stop codon that also has five miR-375 binding site mutationsDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseTagsExpressionMutationMutation on the stop codon of firefly luciferase …PromoterAvailable SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Dynein-2_complex
Plasmid#132536PurposeFull length human (Hs) IFT dynein (dynein-2) complex for Sf9 expression. Contains His-ZZ-TEV-SNAPf-HC, WDR60, WDR34-Strep, LIC3, TCTEX-1, TCTEX1D2, LC8-1, LC8-2, TCTEX-3, Rbl-1, Rbl-2, LC8-like.DepositorInsertsUseTags8x His, Linker-TEV-linker-TEV, SNAPf, Strep, and …ExpressionInsectMutationCodon optimised for Sf9 expressionPromoterAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta/alpha into TRAC HDRT Source (pTR 169)
Plasmid#112021PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-alphaDepositorInsertNYESO beta/alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable SinceSept. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-OSKM
Plasmid#20321PurposeLentiviral plasmid for tet-inducible expression of mouse Oct4, Sox2, Klf4 and Myc for iPS cell generationDepositorUseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
FUW-OSKM
Plasmid#20328PurposeLentiviral plasmid expressing mouse Oct4, Sox2, Klf4 and cMyc for iPS cell generationDepositorUseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha/beta into TRBC1 HDRT Source (pTR 262)
Plasmid#112022PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR with 1G4 NYESO TCR at TCR-betaDepositorInsertNYESO alpha/beta into TRBC1 HDRDT
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable SinceNov. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
NYESO alpha into TRAC HDRT Source (pTR 223)
Plasmid#112023PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-alpha with 1G4 NYESO TCR-alphaDepositorInsertNYESO alpha into TRAC HDRT
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
NYESO beta into TRBC1 HDRT Source (pTR 277)
Plasmid#112024PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-beta with 1G4 NYESO TCR-betaDepositorInsertNYESO beta into TRBC1 HDRT
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TREtight-Ngn2:2A:Ascl1-PGK-Puro (XTP-N2A)
Plasmid#84777PurposeSecond generation lenti expressing Mash1 and Neurogenin for iN transdifferentation to neuronsDepositorUseLentiviralTagsExpressionMutationPromoterpTIGHTAvailable SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d-HexaPro
Plasmid#183515PurposeMammalian cell expression of SARS-CoV-2 Spike protein rS2d-HexaPro with (682-685) furin side replaced with GSAS and mutation S383C, D985C, F817P, A892P, A899P, A942P, K986P,V987PDepositorInsertSpike (S-GSAS-rS2d.HexaPro) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.617.2.v1
Plasmid#182575PurposeMammalian cell expression of SARS-CoV-2 Spike protein Delta variant, furin side replaced by GSAS, 2 Proline at 986 and 987 plus T19R-G142D-del156/157-R158G-L452R-T478K-D614G-P681R-D950NDepositorInsertSpike S-GSAS-B.1.617.2.v1 (T19R-G142D-Del156/157-R158G-L452R-T478K-D614G-P681R-D950N) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR/XBB.1.16
Plasmid#213037PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.16 with with furin side intactDepositorInserts -RRAR.XBB.1.16 (S )
UseTagsHRV 3C cleavage site (before tags) 8X His tag 2X…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 furin site RRAR …PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR-OMICRON.BA.5
Plasmid#213071PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.5 with with furin side intactDepositorInsertpαH-S-RRAR-OMICRON.BA.5 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685, furin site inta…PromoterAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/XBB.1.5
Plasmid#212991Purpose"Mammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.5 variantDepositorInsertpαH-S-GSAS/XBB.1.5 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutation(T19I,Del24/26,A27S,V83A,G142D,Del144,H146Q,Q183E…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/XBB.1.16
Plasmid#212992PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.16DepositorInsertpαH-S-GSAS/XBB.1.16 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutation(T19I,Del24/26,A27S,V83A,G142D,Del144,H146Q, E180…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
UseTagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…PromoterAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-TET-MKOS
Plasmid#20959PurposepiggyBac vector with tet inducible cMyc, KLF4, Oct4, Sox2 for creation of induced pluripotent stem cellsDepositorUsepiggybacTagsIRES-bGeoExpressionMammalianMutationPromoterAvailable SinceApril 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
FUW-SOKM
Plasmid#20325PurposeLentiviral plasmid expressing mouse Sox2, Oct4, Klf4 and cMyc for iPS cell generationDepositorUseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-OMICRON
Plasmid#180593PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertSpike (S-GSAS-2P-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON
Plasmid#180423PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSASDepositorInsertSpike (S-GSAS-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-RRAR/XBB.1.5
Plasmid#212993PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.XBB.1.5 with with furin side intactDepositorInsertSpike S-RRAR/XBB.1.5 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); furin site intake; (T19I…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-CFP-e2a-SOX2AV-p2a-KLF4
Plasmid#193359Purposeself-replicating RNA vector expressing CFP + human SOX2A61V + KLF4 + PuroRDepositorUseVenezuelan equine encephalitis (vee) virus rna re…TagsExpressionMammalianMutationSOX2A61V is a highly cooperative point mutant of …PromoterT7Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-CFP-e2a-SOX2-p2a-KLF4
Plasmid#193358PurposeVEE-CFP-SK (self-replicating RNA vector expressing CFP + human SOX2 + KLF4 + PuroR)DepositorUseVenezuelan equine encephalitis (vee) virus rna re…TagsExpressionMammalianMutationPromoterT7Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-hOKMS
Plasmid#51543PurposeInducible expression of polycistronic 2A spaced OCT4-KLF4-MYC-SOX2DepositorUseLentiviralTagsExpressionMammalianMutationPromotertetOAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-CFP-e2a-SOX2-17-p2a-KLF4
Plasmid#193360PurposeVEE-CFP-S*K (self-replicating RNA vector expressing CFP + human super-SOX + KLF4 + PuroR) for integration-free naïve conversionDepositorUseVenezuelan equine encephalitis (vee) virus rna re…TagsExpressionMammalianMutationSOX2-17 is engineered highly cooperative chimeric…PromoterT7Available SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-VEE-OCT4-t2a-KLF4-e2a-SOX2-17-IRES-GLIS1
Plasmid#193356PurposeVEE-OKS*iG (self-replicating RNA vector expressing human OCT4 + KLF4 + super-SOX + GLIS1 + PuroR) for generation of integration-free iPSCsDepositorUseVenezuelan equine encephalitis (vee) virus rna re…TagsExpressionMammalianMutationSOX2-17 is engineered highly cooperative chimeric…PromoterAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2A
Plasmid#224440PurposeRep/Cap plasmid for the production of MyoAAV 2A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDQTTL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only