We narrowed to 14,501 results for: SHR
-
Plasmid#149590Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA-XMAS-2x
Plasmid#164414PurposeDual targeted guide and cloning vector. Targets pEF-XMAS-2xStop. Guides targeting endogenous sites can be cloned into BbsI sites.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM116: CasRx VEGFA presgRNA
Plasmid#166868PurposeU6-driven expression of human VEGFA targeting presgRNA compatible with CasRx.DepositorInsertHuman VEGFA targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEE495
Plasmid#149291PurposeT-DNA encoding TRV2 with direct repeat multiplexed truncated FT augmented gRNAs targeting NbAGsgRNA1, NbPDS3, NbAGsgRNA2DepositorInsertp35S:TRV2_Direct_NbAGsgRNA1_NbPDS3sgRNA_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS U6 WIP RNAi
Plasmid#11774DepositorAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCfB3041(gRNA X-3)
Plasmid#73283PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry2-sgC9cen
Plasmid#198326PurposeExpresses a guide RNA against a repetitive locus found in the pericentromere of human chromosome 9, with mCherry2 reporterDepositorInsertChr9-CEN guide RNA
ExpressionMammalianPromoterhU6Available SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJMP1239
Plasmid#119263Purposeknockdown folA in P. aeruginosaDepositorInsertsgRNA folA (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTFMT_1
Plasmid#106318PurposeExpress Cas9 and sgRNA targeting MTFMTDepositorInsertsgRNA targeting MTFMT
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3047(gRNA XII-1)
Plasmid#73289PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD2_1
Plasmid#36368DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgSLC19A1
Plasmid#102314Purposegenetic depletion of SLC19A1DepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-ldhA
Plasmid#102288PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting ldhA.DepositorInsertldhA gRNA
UseCRISPRExpressionBacterialPromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 1
Plasmid#70659PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVMG0146_Cq-U6-1_2xBbsI-gRNA
Plasmid#169238PurposeExpression of gRNA in Culex quinquefasciatus or other mosquitoesDepositorInsertCq-U6-1_2xBbsI-gRNA
UseCRISPRExpressionInsectPromoterCPIJ039653Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PRKRA
Plasmid#106109PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting PRKRADepositorInsertgRNA targeting PRKRA (PRKRA Human)
UseCRISPRAvailable SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only