We narrowed to 16,371 results for: grna
-
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX330_MAF1_iso1_2
Plasmid#135750PurposeEncodes gRNA for 3' target of human MAF1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ELK1_iso1_1
Plasmid#135757PurposeEncodes gRNA for 3' target of human ELK1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ELK1_iso1_2
Plasmid#135758PurposeEncodes gRNA for 3' target of human ELK1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_E2F4_iso1_1
Plasmid#135756PurposeEncodes gRNA for 3' target of human E2F4_iso1DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_MAF1_iso1_1
Plasmid#135749PurposeEncodes gRNA for 3' target of human MAF1_iso1DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTC366
Plasmid#91215Purposeprotoplast vector expressing 2 gRNAs targeting tomato ARF8A (CmYLCV promoter, ribozyme processing)DepositorInsert2 gRNAs targeting tomato ARF8A
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HOMEZ_1
Plasmid#86352PurposeEncodes gRNA for 3' target of human HOMEZDepositorInsertgRNA against HOMEZ (HOMEZ Human)
UseCRISPRAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF652_2
Plasmid#86317PurposeEncodes gRNA for 3' target of human ZNF652DepositorInsertgRNA against ZNF652 (ZNF652 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HOMEZ_2
Plasmid#86353PurposeEncodes gRNA for 3' target of human HOMEZDepositorInsertgRNA against HOMEZ (HOMEZ Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_TFE3_1
Plasmid#86325PurposeEncodes gRNA for 3' target of human TFE3DepositorInsertgRNA against TFE3 (TFE3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HBP1_1
Plasmid#86320PurposeEncodes gRNA for 3' target of human HBP1DepositorInsertgRNA against HBP1 (HBP1 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF652_1
Plasmid#86316PurposeEncodes gRNA for 3' target of human ZNF652DepositorInsertgRNA against ZNF652 (ZNF652 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_84
Plasmid#60076PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_83
Plasmid#60075PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_82
Plasmid#60074PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_80
Plasmid#60072PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-AAVS1
Plasmid#113194PurposeEncodes gRNA for human AAVS1DepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only