We narrowed to 1,793 results for: plasmid for e coli
-
Plasmid#196703PurposePlasmid for transient mammalian expression of catalytically inactive RNase H1 mutant.DepositorInserthuman RNaseH1 D210N
ExpressionMammalianMutationD210N, catalytically inactiveAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
CGBE1 (pRZ3885)
Plasmid#140252PurposeCMV promoter expression plasmid for UNG(E.coli)-rAPOBEC1(R33A)-nCas9-P2A-EGFPDepositorInserteUNG-BE4max(R33A)-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, D10A in Cas9PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas-CmR(+)
Plasmid#113633PurposeChloramphenicol resistant derivative of pCas plasmidDepositorInsertChloramphenicol resistance gene
UseCRISPRPromoterPcatAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSynI-rtTAV16
Plasmid#102367PurposeAAV vector to drive TET-ON activator expression from human synapsin I promoterDepositorInsertrtTAV16
UseAAVExpressionMammalianMutationrtTA variant reported in Gene Therapy (2006) 13, …Promoterhuman synapsin I promoterAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCN38-kimA-yfp
Plasmid#227635Purposec-di-AMP biosensor plasmid. Encodes yfp downstream of c-di-AMP-binding kimA riboswitch. Plasmid confers ampicillin resistance to E. coli and chloramphenicol resistance to S. aureus.DepositorInsertkimA-yfp
ExpressionBacterialAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCN34e-kimA-yfp
Plasmid#227638Purposec-di-AMP biosensor plasmid. Encodes yfp downstream of c-di-AMP-binding kimA riboswitch. Plasmid confers ampicillin resistance to E. coli and erythromycin resistance to S. aureus.DepositorInsertkimA-yfp
ExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCN34e-ktrA-yfp
Plasmid#227640Purposec-di-AMP biosensor plasmid. Encodes yfp downstream of c-di-AMP-binding ktrA riboswitch. Plasmid confers ampicillin resistance to E. coli and erythromycin resistance to S. aureus.DepositorInsertktrA-yfp
ExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCN38-ktrA-yfp
Plasmid#227636Purposec-di-AMP biosensor plasmid. Encodes yfp downstream of c-di-AMP-binding ktrA riboswitch. Plasmid confers ampicillin resistance to E. coli and chloramphenicol resistance to S. aureus.DepositorInsertktrA-yfp
ExpressionBacterialAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
hisSUMO-mZFP57
Plasmid#87224PurposeExpress hisSUMO tagged Zinc finger protein 57 F1-F3(mouse) in E. coliDepositorAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-SAR1
Plasmid#67388PurposeExpression of native hSar1 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)-Is-PETase-W159H-S238F
Plasmid#112203PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1) with W159H and S238F mutations, codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6 with W159H and S238F mutations, codon optimized for expression in E. coli K12
Tags6XHISExpressionBacterialMutationW159H, S238FPromoterN/AAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-21b(+)-Is-PETase-W185A
Plasmid#112204PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1) with W185A mutations, codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6 with W185A mutation, codon optimized for expression in E. coli K12
Tags6XHISExpressionBacterialMutationW185APromoterN/AAvailable SinceJuly 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-Cre
Plasmid#219798PurposeExpresses a codon-optimized His-tagged Cre recombinase in E. coli. Plasmid ID in Yvert lab is pGY709DepositorInsertCodon-optimized Cre Recombinase
TagsHIS-tag for purificationExpressionBacterialPromoterIPTG-inducibleAvailable SinceMay 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJJGL004
Plasmid#180608PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-PlmCasX+Region1 insertionDepositorInsertPlmCasX with DpbCasX R1 loop
UseCRISPRTags10xHis and MBPExpressionBacterialPromoterT7Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlc_N + pSiMPlc_C
Plasmid#134312PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertcmR_gp41-1 N-intein + cmR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlk_N + pSiMPlk_C
Plasmid#134310PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertkanR_gp41-1 N-intein + kanR_gp41-1 C-intein
ExpressionBacterialAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPla_N + pSiMPla_C
Plasmid#134314PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInsertampR_gp41-1 N-intein + ampR_gp41-1 C-intein
ExpressionBacterialAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSiMPlh_N + pSiMPlh_C
Plasmid#134316PurposeMaintenance of 2 plasmids with a single antibiotic in E. coliDepositorInserthygR_gp41-1 N-intein + hygR_gp41-1 C-intein
ExpressionBacterialMutationP254Q in hygR_gp41-1 N-inteinAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIMAY
Plasmid#68939PurposeE. coli/staphylococcal temperature-sensitive plasmid for allelic exchangeDepositorTypeEmpty backboneUseStaphylococcal allelic exchange vectorAvailable SinceSept. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Yellow
Plasmid#160443PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Yellow chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Yellow
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Violet
Plasmid#160447PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Violet chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Violet
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1E
Plasmid#160442PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1 chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-SS-352
Plasmid#68791PurposeZF9 Op x6 -- GFP-IRES-NTRDepositorInsertsZF9 Op 6x
EGFP
Nitroreductase
TagsIRESExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Magenta
Plasmid#160446PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Magenta chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Magenta
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a_LolT_C41S
Plasmid#211789PurposeExpression plasmid in E. coli BL21(DE3) , which can be used for expression and purification to get protein LolT_C41SDepositorInsertlolt mutant
TagsHis tagExpressionBacterialPromoterT7 promoterAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0248
Plasmid#162313PurposeReporter plasmid for T7-driven E. coli cell-free protein synthesis with detection via HiBiTDepositorInsertT7prom-RBS-sfGFP-HiBiT
UseSynthetic BiologyAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Pink
Plasmid#160445PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Pink chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Pink
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0245
Plasmid#162284PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0729
Plasmid#162316PurposeTEV protease plasmid for T7-driven E. coli cell-free protein synthesisDepositorInsertT7prom-RBS-NET-TEVprotease
UseSynthetic BiologyAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Orange
Plasmid#160444PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Orange chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Orange
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPMY1CB0001
Plasmid#162317PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-CCAT. Generates plasmids for T7-driven expression in E. coli. Contains mRFP1 reporter.DepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0025
Plasmid#162283PurposeAcceptor for golden gate assembly with BsaI overhangs GCTT-AATG. Generates plasmids for T7-driven E. coli cell-free protein synthesisDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-MCN-10His-mStayGold (E138D)
Plasmid#211361PurposeBacterial expression of the bright and photostable monomeric StayGold fluorescent protein (E138D). Codon optimised for expression in Escherichia coli. Contains a N-terminal 10xHis tag.DepositorInsertmStayGold
Tags10xHis-tagExpressionBacterialMutationE138DPromoterT7Available SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70DA9-Pct5-DadhABC(A2)
Plasmid#191632PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_SulR
Plasmid#186425Purposetranscriptional unit for sulfadiazine resistance; plant expression driven by the Pnos promoterDepositorInsertSulR
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadH)-Pdadh-DadhABC(A2)
Plasmid#191644PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pProUSER13F4C
Plasmid#178023PurposeE. coli - B. subtilis nicking vector pProUSER13F4C. Ap-BBR1; ΔsigF-insertion-site; Km; manR-PmanADepositorInsertnicking site to be replaced with your gene of interest
ExpressionBacterialPromoterPmanAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pProUSER13E3F
Plasmid#178026PurposeE. coli - B. subtilis nicking vector pProUSER13E3F. Ap-BBR1; yhgE-insertion-site; Spc; tetR-PtetDepositorInsertnicking site to be replaced with your gene of interest
ExpressionBacterialPromoterPtetAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only