We narrowed to 19,089 results for: iNOS
-
Plasmid#231994PurposeCRISPRi-ART crRNA only plasmid encoding crystal violet-inducible crRNA (for dRfxCas13d) with 2xBsaI spacer cloning siteDepositorInsertcrRNA of dRfxCas13d
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterpJEx (Jungle Express)Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB53x EF1-Dendra2-RPB1Amr
Plasmid#81228Purposeexpresses Dendra2-Rpb1 fusion in mammalian cells. Possible to insert into the genome using the Piggibac systemDepositorInsertDendra2 - Rpb1 (alpha amanitin resistant) (POLR2A Human)
UseTagsDendra2ExpressionMammalianMutationN792D alpha amanitin resistance mutation (Bartolo…PromoterEF1aAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AMBRA1-3xFLAG
Plasmid#172605PurposeExpresses 3xFLAG-tagged AMBRA1 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hPGRN
Plasmid#213682PurposeExpresses human progranulin (PGRN) with an N-terminal twin-Strep-V5 tagDepositorInsertHuman Progranulin (hPGRN) (GRN Human)
UseAAVTagsTwin-Strep tag and V5 tag (after signal peptide)ExpressionMutationPromotercytomegalovirus enhancer/chicken β-actin promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Slc17a7-IRES2-Cre targeting vector
Plasmid#61574PurposeTarget the Cre recombinase gene to the stop codon of the mouse Slc17a7 (VGlut1) geneDepositorInsertSlc17a7-IRES2-Cre
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
Plasmid#173029PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.DepositorInsertpspCas13b
UseCRISPR and LentiviralTags3xFLAG, BFP, HIV NES, and T2AExpressionMammalianMutationPromoterEf1aAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBabe.puro.CDK8.flag
Plasmid#19758DepositorInsertcyclin-dependent kinase 8 (CDK8 Human)
UseRetroviralTagsFlagExpressionMammalianMutationPromoterAvailable SinceDec. 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChRmine-oScarlet
Plasmid#137160PurposeIntersectional viral expression of ChRmine-p2a-oScarlet in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChRmine-p2a-oScarlet
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationoScarlet E95DPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A Δ450-572-pBabe-Puro
Plasmid#25958DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…PromoterAvailable SinceSept. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-Acridone-RS1 (A7)
Plasmid#197566PurposeExpression of Methanomethylophilus alvus (Ma) Acridone RS1 (A7) tRNA synthetase/Pyl-tRNA pair for the encoding of Acridone at TAG codons in HEK293 cellsDepositorInsertsM. alvus PylRS - Acd RS1 (A7)
M. alvus Pyl-tRNA (6) (4x copies)
UseTagsNoneExpressionMammalianMutationN166A, V168G, W239CPromoterCMV and U6/H1Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS2181
Plasmid#158421PurposeAAV plasmid with Ple32 (CLDN5 MiniPromoter) driving expression of EmGFP. Contains WPRE.DepositorAvailable SinceFeb. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-SRSF1-V5-mCherry
Plasmid#235088PurposeSRSF1 mCherry fusion protein with MCP domainDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6F
Plasmid#137123PurposeIntersectional viral expression of GCaMP6F in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtTagsExpressionMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 KBTBD4 WT
Plasmid#184627PurposeMammalian expression vector with N-terminal 3xFlag for KBTBD4 WT expression in mammalian cellsDepositorInsertN-terminal 3xFlag tagged KBTBD4 WT (KBTBD4 Human)
UseTagsExpressionMammalianMutationno mutationPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-MjACE2 (Pangolin)
Plasmid#158084PurposeExpresses pangolin ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1E
Plasmid#224439PurposeRep/Cap plasmid for the production of MyoAAV 1E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDTMSK insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDule2-3-nitroTyrosine (A7)
Plasmid#174079PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the third generation Mj 3NY (A7) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
UseTagsExpressionBacterialMutationY32H H70T D158H I159A L162RPromoterGlnRS (constitutive)Available SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX2-tTA2-WPRE-bGHpA
Plasmid#65458PurposeCan be used to generate AAV virus that will express the tetracycline transactivator tTA2 from the CAG promoter in a Cre-dependent mannerDepositorInserttTA2
UseAAVTagsExpressionMutationPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-6A
Plasmid#51248PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907,980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907,980,1006 mutated to A…PromoterEF1aAvailable SinceMarch 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only