We narrowed to 30,121 results for: LIS;
-
Plasmid#180540PurposeEntry vector containing Signal peptide region of CsgA including SecB-N22 sequencedDepositorInsertSignal peptide region of CsgA including SecB-N22 sequenced
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_095
Plasmid#180524PurposedCas9 KTK compatible plasmid. Contains dCas9 and lacZ dropout region with flanking D1.1 overhangs for insertion of gRNA expression assemblyDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_324
Plasmid#180566PurposeSpacer sequence in 2.2b format to allow for level 3 cloning with D2.2aDepositorInsertSpacer sequence in 2.2b format to allow for level 3 cloning with D2.2a
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Myc-gamma3/gamma2SIL
Plasmid#121433PurposeGABAA receptor expression (chimeric rat gamma 3 subunit whose large intracellular loop has been replaced with the large intracellular loop of the rat gamma 2 short subunit) Myc-tag near N-terminusDepositorUseTagscMyc epitope EQKLISEEDL inserted between fourth a…ExpressionMammalianMutationPromoterAvailable sinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Myc-gamma1/gamma2SIL
Plasmid#121432PurposeGABAA receptor expression (chimeric rat gamma 1 subunit whose large intracellular loop has been replaced with the large intracellular loop of the rat gamma 2 short subunit) Myc-tag near N-terminusDepositorUseTagscMyc epitope EQKLISEEDL inserted between fourth a…ExpressionMammalianMutationPromoterAvailable sinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Hspb3 in situ probe
Plasmid#45629DepositorInsertHspb3 in situ probe (Hspb3 Mouse)
UseIn situTagsExpressionMutationfragment contains nt 30-661 of Hspb3 mRNA sequenc…PromoterAvailable sinceJune 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
SPDK3888(TRV-RNA2-pPEBV-MCS-AtIleu-tRNA)
Plasmid#149276PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAsDepositorInsertModified TRV RNA2 with PEBV promoter and AtIleu-tRNA mobile RNA sequence
UseT-dna vectorTagsExpressionMutationT2318C (DNA) in PEBV coat protein sequencePromoterAvailable sinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT2KXIG (Tol2)-tp63:ikk1KD:GFP
Plasmid#105645PurposeKinase-deleted Ikk1(alpha) expression in basal keratinocytesDepositorInserttp63:ikk1KD:GFP (chuk Zebrafish)
UseTagsGFPExpressionMammalianMutationp63 promoter + ikk1 (kinase domain deleted) + GFPPromoterAvailable sinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
LLP457 pGK-dCas9-Suntag-BFP
Plasmid#100957PurposeBPF version of LLP339, Puro is replaced by BFP driven by EF1a, dCas9 with SungTagx10 driven by pGK, with 3xHA tagDepositorInsertdCas9, SunTag array (10xGCN4)
UseCRISPRTags3xHA and BFPExpressionMammalianMutationD10A, H840A for dCas9PromoterAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pShuttle CMV RGECO-TnT
Plasmid#124643PurposeMyofilament localised red genetically encoded calcium sensor in mammalian expression vector used for AdEasy adenoviral DNA recombination.DepositorInsertRGECO-TnT (TNNT2 Synthetic, Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-BLM DM
Plasmid#80071PurposeExpression of a sumo-mutant form GFP-BLM with K317R and K331R sumo-site mutationsDepositorInsertBLM (BLM Human)
UseTagsGFP-BLMExpressionMammalianMutationK317R (AAA>AGA) and K331R (AAA>AGA)PromoterAvailable sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
SPDK3889(TRV-RNA2-pPEBV-MCS-AtMet-tRNA)
Plasmid#149277PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAsDepositorInsertModified TRV RNA2 with PEBV promoter and AtMet-tRNA mobile RNA sequence
UseT-dna vectorTagsExpressionMutationT2318C (DNA) in PEBV coat protein sequencePromoterAvailable sinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-PARP1-Flag-His-7xKQ
Plasmid#111573PurposeExpresses full length PARP1 with K to Q mutations in automodification domain in Sf9 (insect) cellsDepositorInsertPARP1 (PARP1 Human)
UseTagsC-terminal 6xHis and C-terminal FlagExpressionInsectMutationlysine to glutamine mutation at the following ami…Promoterpolyhedrin promoterAvailable sinceJuly 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Vglut2 in situ probe
Plasmid#45639DepositorInsertVglut2 in situ probe (Slc17a6 Mouse)
UseIn situTagsExpressionMutationfragment contains nt 2477-2993 of slc17a6 (Vglut2…PromoterAvailable sinceJune 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCGN K-Ras 12V, 188L
Plasmid#14722DepositorInsertK-ras (KRAS Human)
UseTagsHAExpressionMammalianMutation12V, 188LPromoterAvailable sinceAug. 29, 2007AvailabilityAcademic Institutions and Nonprofits only -
SPDK3902(TRV-RNA2-pPEBV-MCS-AtGly-tRNA)
Plasmid#149278PurposeModified Tobacco rattle virus RNA2 vector that could be used for expression of sgRNAsDepositorInsertModified TRV RNA2 with PEBV promoter and AtGly-tRNA mobile RNA sequence
UseT-dna vectorTagsExpressionMutationT2318C (DNA) in PEBV coat protein sequencePromoterAvailable sinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTH728-CEN-RLuc/maxCFLuc
Plasmid#38212DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pShuttle CMV RGECO-TnI
Plasmid#124642PurposeMyofilament localised red genetically encoded calcium sensor in mammalian expression vector used for AdEasy adenoviral DNA recombinationDepositorInsertRGECO-TnI (TNNI3 Synthetic, Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTH726-CEN-RLuc/minCFLuc
Plasmid#38210DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
K15-TK/pGL3
Plasmid#44267DepositorInsertK15 promoter (-4.8) (Krt15 Mouse)
UseMouse Targeting; Thymidine kinaseTagsHSV-1 TKExpressionMammalianMutationContains the murine K15 promoter (-4.8) fragmentPromotermurine K15 promoter (-4.8) fragmentAvailable sinceApril 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
ptdTomato-N1-CMVL-ikk1FL(C179A)-tdTomato
Plasmid#105644PurposeZebrafish Inhibitor of kappa B kinase alpha with mutation at position 179 from cysteine to alanineDepositorInsertCMVL-ikk1FL(C179A)-tdTomato (chuk Zebrafish)
UseTagstdTomatoExpressionMammalianMutationCMV:ikk1FL(C178A)-tdTomatoPromoterAvailable sinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2KXIG (Tol2)-tp63:ikk1C179A:GFP
Plasmid#105647PurposeExpression of Ikk1(alpha) with mutated cysteine residues at position 179 in basal keratinocytesDepositorInserttp63:ikk1C179A:GFP (chuk Zebrafish)
UseTagsGFPExpressionMammalianMutationp63 promoter + ikk1C179A + GFPPromoterAvailable sinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertUseTags1D4ExpressionMammalianMutationPromoterCMVAvailable sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH742-CEN-RLuc/slowminCFLuc
Plasmid#38222DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
KTK_219
Plasmid#180534PurposeEntry vector containing K.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_223
Plasmid#180538PurposeEntry vector containing K.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_226
Plasmid#180552PurposeEntry vector containing K.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_218
Plasmid#180533PurposeEntry vector containing K.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only