We narrowed to 14,497 results for: SHR;
-
Plasmid#133561PurposegRNA vector for targeting near the attP40 locus, use with pHD-3XP3-dsRed-DattP-CRISPR-donor-attP40 based constructsDepositorInsertattP40 region guide RNAs
UseCRISPRExpressionInsectPromoterU6Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_mic
Plasmid#184916PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_mic recombines in vivo with a PCR product from pEasyG2_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3015b
Plasmid#209317PurposeExpresses a sgRNA template with a protospacer cloning site flanked by BsaI restriction sites for easy insertion of a targeting cassette.DepositorInsertGroup B Streptococcus-compatible single guide RNA
ExpressionBacterialPromoterXyl/tet promoter that is constitutively activeAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA3_dTet_NGFR
Plasmid#189803PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA3 (Runx1 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Bsn KI
Plasmid#139664PurposeEndogenous tagging of Bassoon: N-terminal (amino acid position: L7)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti-KRAS-G12C-tmpknot-epegRNA
Plasmid#214094PurposeLentiviral vector expressing epegRNA to induce KRAS G12C mutationDepositorInsertKRAS G12C epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-pA
Plasmid#192488PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH2_3
Plasmid#36389DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgs2_B6
Plasmid#170300PurposeA knock-out vector for the mouse Ptgs2 in C57BL6DepositorInsertA gRNA targeting the mouse tyrosinase gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDF0250 DisCas7-11 full locus with Golden gate acceptor site for spacer
Plasmid#172501PurposeEncodes the DisCas7-11 full locus along with a DR and golden gate site for cloning spacersDepositorInsertDisCas7-11 full locus with Golden gate acceptor site for spacer
ExpressionBacterialAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 Human 3' HP1a gRNA
Plasmid#127907PurposeWT Cas9 Vector targeting the 3' end of the human HP1a geneDepositorInsertgRNA for Human 3' HP1a
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgRNA-MS2-U6
Plasmid#171694PurposeTo construct expression vector for tBE-V5-mA3DepositorInsertsgRNA scaffold-MS2-U6
UseCRISPRExpressionMammalianAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCB619
Plasmid#171011PurposeCRISPR sgRNA vector (puro-BFP with BstXI/BlpI digest sites).DepositorInsertU6:sgRNA_Puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E1.3 gRNA
Plasmid#90880Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
EZH2 E10.3 gRNA
Plasmid#90685Purpose3rd generation lentiviral gRNA plasmid targeting human EZH2DepositorInsertEZH2 (Guide Designation E10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan-ADE2
Plasmid#232105PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only