We narrowed to 13,356 results for: ache
-
Plasmid#162118PurposemCherry linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; mCherry linked to HA-FLAG-AU1
UseLentiviralTagsHA-FLAG-AU1MutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx-FRT Kir2.1-2A-GFP
Plasmid#161577PurposeExpression of Kir2.1-2A-GFP in a Flp-dependent fashionDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
shCTNNB1 # 2
Plasmid#42544DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
shCTNNB1 # 1
Plasmid#42543DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-RR
Plasmid#108860PurposeLbCpf1 Gateway entry plasmid with G548R and K611R mutationsDepositorInsertLbCpf1-RR (LbCpf1 with G548R and K611R mutations)
UseCRISPR; Gateway compatible cpf1 entry cloneTagsNLSExpressionPlantMutationG548R and K611R, Cpf1 is rice codon optimizedAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-TEV-CyOFP1
Plasmid#105799PurposeExpression of your protein of interest in fusion with orange fluorescent protein at the C-terminus (cleavable by TEV) (PMID: 27240196). CyOFP1 is useful for multi-channel imaging.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-CyOFP1ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAC-CTSS
Plasmid#172415PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_HDLBP
Plasmid#154448PurposeFor recombination of HDLBPDepositorInsertHDLBP (HDLBP Human)
ExpressionMammalianAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET41b+_Ufd1-His
Plasmid#117107PurposeProduction of recombinant Ufd1-His in E.coliDepositorAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTP434
Plasmid#104167PurposeBacterial expression plasmid of anti-GFP nanobody with 3x Cysteines for maleimide labelingDepositorInsertAnti-GFP nanobody Enhancer PDB 3K1K (3x Cysteine)
Tags14x Histidine tag and NEDD8 from Brachypodium dis…ExpressionBacterialMutation3x Cysteines located at bps 493-495, 520-522, and…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSP90(G97D)-mOFP
Plasmid#228195Purposeexpressed human Hsp90 (G97D mutation) with a mOFP fluorescent protein tagDepositorInsertHSP90AA1(G97D) (HSP90AA1 Human)
TagsmOFPExpressionMammalianMutationG97D mutationPromoterCMVAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-BAFFR-CFP
Plasmid#187002PurposeExpression of human BAFFR-CFP fusion proteinDepositorAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1_RAF1 (51-131)
Plasmid#119218Purposepurification of GST-RAF1 RBD from E. coliDepositorInsertRAF1 aa 51-131 (RAF1 Human)
ExpressionBacterialAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
shTCF7L2 # 1
Plasmid#42557DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBX_Sec61b_smGFP_Myc
Plasmid#236092PurposeConstitutively encodes Sec61b-smGFP-Myc (sfGFP-based spaghetti monster fluorescent protein embedding Myc epitope tags), for targeting the endoplasmic reticulum.DepositorInsertSec61b-smGFP-Myc (SEC61B Human, Synthetic)
ExpressionMammalianAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SopB
Plasmid#183657PurposeN-terminally tagged Salmonella Typhimurium SopB for mammalian expressionDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only