We narrowed to 22,939 results for: REP
-
Plasmid#199396PurposeMammalian expression plasmid of Anti-Nav1.2 Na+ channel [K69/33R] (Rat). Derived from hybridoma K69/33.DepositorInsertAnti-Nav1.2 Na+ channel (Rat) recombinant mouse monoclonal antibody (Scn2a Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-GluA2/GluR2 glutamate receptor [L21/32R-2b]
Plasmid#199405PurposeMammalian expression plasmid of Anti-GluA2/GluR2 glutamate receptor [L21/32R-2b] (Rat). Derived from hybridoma L21/32.DepositorInsertAnti-GluA2/GluR2 glutamate receptor (Rat) recombinant mouse monoclonal antibody (Gria2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-GFAP [N206A/8R-2b]
Plasmid#199410PurposeMammalian expression plasmid of Anti-GFAP [N206A/8R-2b] (Human). Derived from hybridoma N206A/8.DepositorInsertAnti-GFAP (Human) recombinant mouse monoclonal antibody (GFAP Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-GluN2B/NR2B glutamate receptor [N59/36R-2b]
Plasmid#199418PurposeMammalian expression plasmid of Anti-GluN2B/NR2B glutamate receptor [N59/36R-2b] (Rat). Derived from hybridoma N59/36.DepositorInsertAnti-GluN2B/NR2B glutamate receptor (Rat) recombinant mouse monoclonal antibody (Grin2b Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgM-IRES-GFP
Plasmid#187011PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgMDepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgM
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgA1-IRES-GFP
Plasmid#187007PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgA1DepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgA1
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKD2
Plasmid#170847PurposeAAV backbone for Cre-dependent transgene expression of any transgene in cortical interneurons under the control of the Dlx enhancer.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2
Plasmid#170853PurposeAAV backbone for Cre-dependent transgene expression of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS6-GFP
Plasmid#178714PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-dTom
Plasmid#178718PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertdTom
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-GFP
Plasmid#178713PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertGFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG
Plasmid#179081PurposeNOTE: An improved version of this plasmid is now available. See Addgene plasmid #242072. All-in-one prime editor piggyBac transposon, SpG variantDepositorInsertSpCas9 SpG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135L, S1136W, G1218K, E1219Q, R1335Q, T1337RPromoterCAGAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-GABA(A)R, Gamma2L/S [N452/73R]
Plasmid#177553PurposeMammalian Expression Plasmid of anti-GABA(A)R, Gamma2L/S (Human). Derived from hybridoma N452/73.DepositorInsertanti-GABA(A)R, Gamma2L/S (Homo sapiens) recombinant mouse monoclonal antibody (GABRG2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cav1.2/1.3 Ca2+ channel [L57/46R]
Plasmid#177485PurposeMammalian Expression Plasmid of anti-Cav1.2/1.3 Ca2+ channel (Rabbit). Derived from hybridoma L57/46.DepositorInsertExpressionMammalianPromoterDual CMVAvailable SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-HRV3C/D614G
Plasmid#164568PurposeSARS-CoV-2 Spike protein with furin site mutated to HRV3C site and D614G mutation (S-HRV3C-D614G variant)DepositorInsertSpike (S-HRV3C-D614G variant)
Tags2X Strep-Tag II and 8X His tagExpressionMammalianMutationD614GAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 LiON
Plasmid#252093PurposeTransient expression of LiON (Labile iron and Oxygen Notifier) for imaging intracellular bioavailable iron and oxygen in live cellsDepositorInsertLiON (Labile iron and Oxygen Notifier)
ExpressionMammalianAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKRB156
Plasmid#254233PurposeThis pMV361-derived E. coli-Mycobacterium shuttle vector contains the iRFP670 and HoI driven by the hsp60 promoter, as well as a kanamycin resistance cassette.DepositorInsertsiRFP670
HoI
ExpressionBacterialPromoterhsp60Available SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKRB129
Plasmid#253817PurposeThis pMV361-derived E. coli-Mycobacterium shuttle vector contains the luxCDABE operon driven by the hsp60 promoter, as well as a kanamycin resistance cassette.DepositorInsertlucCDABE
ExpressionBacterialPromoterhsp60Available SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV[Tet]-No marker-TRE3G>rPou5f1(ns):F2A:rKlf4:IRES:rSox2*:E2A:rMyc*
Plasmid#249058PurposeDox inducible expression of rat OKSMDepositorUseLentiviralPromoterTRE3GAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only