We narrowed to 40,824 results for: Ina;
-
Plasmid#84636PurposeEncodes negative-control C-terminal (substrate) fragment of bimolecular AMPK/BRSK activity reporter (bimABKAR); cytosol targeted; use in conjunction with pcDNA3-Cerulean-FHA1-NESDepositorInsertAMPKsub(TA)-YPet-NES
UseTags6xHis, Nuclear export signal (NES), T7 tag (gene …ExpressionMammalianMutationTarget Thr residue in substrate domain mutated to…PromoterCMVAvailable sinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-(STChRger2-TS-EYFP)
Plasmid#129394PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Uses the CAG promoter and double floxed.DepositorInsertsoma targeted ChRger2
UseAAV and Cre/LoxTagsKv2.1-TS-EYFPExpressionMammalianMutationPromoterCAGAvailable sinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
MTRAP-bio
Plasmid#47746PurposeExpresses enzymatically monobiotinylated full-length MTRAP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MTRAP
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(S)-Fc-His
Plasmid#72138PurposeExpresses the Sema3A protein (truncated at cleavage site P1; ie, short), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA Myc-mMEKK2
Plasmid#44158DepositorInsertMekk2 (Map3k2 Mouse)
UseTagsMycExpressionMammalianMutationPromoterAvailable sinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb6-flag
Plasmid#86770PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 6 (PSMB6 Human)
UseLentiviralTagsflagExpressionMammalianMutationPromoterunknownAvailable sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
EBA140-bio
Plasmid#47742PurposeExpresses enzymatically monobiotinylated full-length EBA140 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised EBA140
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 GW-mCit-PA
Plasmid#113449PurposeProteinA-mCitrine Gateway shuttle vector for C-terminal fusionsDepositorTypeEmpty backboneUseGateway shuttle vectorTagsmCitrine-ProteinAExpressionMammalianMutationPromoterCMVAvailable sinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
Neo1.a-Fc-His
Plasmid#72089PurposeExpresses the extracellular region of the Neogenin 1, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNeo1.a (Neo1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmEMBer
Plasmid#174441PurposePlasma membrane-targeted ERK monobody binder for local inhibition of ERK activity in live cells.DepositorInsertpmEMBer
UseTags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-deSpCas9-VP64-6xHis
Plasmid#92117PurposeExpression of dead/inactive increased fidelity eSpCas9 (1.1)-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive eSpCas9-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, H840A, K848A, K1003A, R1060APromoterT7Available sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
G718A_BattB(GA)_TKterm_AttB(GT)_sGFP-PTEN-IRES-mCherry-P2A-HygroR_noTerm_attP(GA)_IRES-UnaG-2A-Puro-Term
Plasmid#200634PurposePlasmid self-excising recombination plasmid for Matreyek Bxb1(GT) landing padDepositorInsertPTEN (PTEN Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST JNKKTR AE Clover
Plasmid#90240PurposeLentiviral vector to express JNK KTR AE (mutant) mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (AE mutant)
UseLentiviralTagsmCloverExpressionMammalianMutationPromoterPGKAvailable sinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
FusionRed-Dectin1A-C-10
Plasmid#56111PurposeLocalization: Membrane, Excitation: 580, Emission: 608DepositorInsertDectin1A (CLEC7A Human)
UseTagsFusionRedExpressionMammalianMutationPromoterCMVAvailable sinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1 PA-mCit-GW
Plasmid#113448PurposeProteinA-mCitrine Gateway shuttle vector for N-terminal fusionsDepositorTypeEmpty backboneUseGateway shuttle vectorTagsProteinA-mCitrineExpressionMammalianMutationPromoterCMVAvailable sinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-MCS-P2A-EGFP
Plasmid#176276PurposeViral vector for co-expression of a CDS of interest and EGFP in cells expressing Cre AND NOT Flp driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.DepositorInsertMCS-P2A-EGFP
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterhuman Synapsin IAvailable sinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_K95M
Plasmid#108106PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & kinase-dead mutation) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable sinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema5a-Fc-His
Plasmid#72161PurposeExpresses the extracellular region of the Sema5A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema5a (Sema5a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only