We narrowed to 4,987 results for: CAPS
-
Plasmid#134285PurposeExpresses Myc-tagged SCAP in mammalian cellsDepositorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pCap-SG5-Hgy
Plasmid#227580PurposeCapture plasmid with hygromycin resistance and pSG5 repliconDepositorTypeEmpty backboneUseTagsExpressionMutationPromoterAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1E
Plasmid#224439PurposeRep/Cap plasmid for the production of MyoAAV 1E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDTMSK insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B3
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available SinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterEF1a and U6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-2
Plasmid#218797PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-2
UseTagsExpressionMammalianMutationPromoterAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAP03-sp44/p21
Plasmid#120232PurposeCarries bidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites that can be amplified with homology sequence for refactoring.DepositorInsertbidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites
UseSynthetic BiologyTagsExpressionMutationaac(3)IV (apramycin resistance gene)PromoterAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1C
Plasmid#224438PurposeRep/Cap plasmid for the production of MyoAAV 1C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDLSTP insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEntry_SARS-CoV-2-Nucleocapsid
Plasmid#168886PurposeGateway-compatible Entry vectorDepositorInsertSARS-CoV-2-Nucleocapsid (N )
UseGateway-compatible entry vectorTagsExpressionMutationPromoterAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV Nucleocapsid
Plasmid#154269PurposeExpresses myc-tagged nucleocapsid (N) from SARS-CoV (1) in mammalian cellsDepositorInsertSARS-CoV Nucleocapsid
UseTags5X myc epitopeExpressionMammalianMutationPromoterCMVAvailable SinceSept. 16, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
kiCAP-AAV-MyoAAV2E
Plasmid#224441PurposeRep/Cap plasmid for the production of MyoAAV 2E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDQGYQ insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3D
Plasmid#224445PurposeRep/Cap plasmid for the production of MyoAAV 3D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYREL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3E
Plasmid#224446PurposeRep/Cap plasmid for the production of MyoAAV 3E, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4B
Plasmid#224449PurposeRep/Cap plasmid for the production of MyoAAV 4B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYTSV insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4D
Plasmid#224451PurposeRep/Cap plasmid for the production of MyoAAV 4D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4C
Plasmid#224450PurposeRep/Cap plasmid for the production of MyoAAV 4C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYTSM insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3C
Plasmid#224444PurposeRep/Cap plasmid for the production of MyoAAV 3C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYSSV insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3B
Plasmid#224443PurposeRep/Cap plasmid for the production of MyoAAV 3B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationRGDYSGL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_13
Plasmid#194674PurposeProtein production of the split HaloTag based calcium recorder Caprola_13 in bacteriaDepositorInsertCaprola_13
UseTagsHis-tag and Strep-tagExpressionBacterialMutationPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_05
Plasmid#194666PurposeProtein production of the split HaloTag based calcium recorder Caprola_05 in bacteriaDepositorInsertCaprola_05
UseTagsHis-tag and Strep-tagExpressionBacterialMutationPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_01
Plasmid#194662PurposeProtein production of the split HaloTag based calcium recorder Caprola_01 in bacteriaDepositorInsertCaprola_01
UseTagsHis-tag and Strep-tagExpressionBacterialMutationPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pESC-NAT-LACap
Plasmid#80763PurposeExpresses truncated L-A capsid for curing satellite virusDepositorInsertL-A cDNA (L-A Cap)
UseTagsExpressionYeastMutationPromoterPGK1Available SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.V2
Plasmid#127848Purposenon-standard AAV2 rep-AAV-PHP.V2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.V2 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
iCAP-BI155-KanR
Plasmid#209527PurposeRepCap for AAV productionDepositorInsertAAV-BI155 Cap
UseTagsExpressionMammalianMutationPromoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B4
Plasmid#127849Purposenon-standard AAV2 rep-AAV-PHP.B4 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B4 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-CMV2 ACAP1
Plasmid#15697DepositorAvailable SinceNov. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_CAPNS1_EF-hand_8+EF-hand_5
Plasmid#109995PurposeProtein expression and purification of CAPNS1_EF-hand_8+EF-hand_5DepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-229E-Nucleocapsid
Plasmid#168967PurposeGateway-compatible Entry vectorDepositorInsertHCoV-229E-Nucleocapsid (N )
UseGateway-compatible entry vectorTagsExpressionMutationPromoterAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-OC43-Nucleocapsid
Plasmid#168947PurposeGateway-compatible Entry vectorDepositorInsertHCoV-OC43-Nucleocapsid (EYW02_gp8 )
UseGateway-compatible entry vectorTagsExpressionMutationPromoterAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEntry_MERS-CoV-Nucleocapsid
Plasmid#168833PurposeGateway-compatible Entry vectorDepositorInsertMERS-CoV-Nucleocapsid (N )
UseGateway-compatible entry vectorTagsExpressionMutationPromoterAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1C
Plasmid#196685PurposeRep/Cap plasmid for the production of PAL1C, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationPTQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEntry_HCoV-HKU1-Nucleocapsid
Plasmid#168906PurposeGateway-compatible Entry vectorDepositorInsertHCoV-HKU1-Nucleocapsid (N )
UseGateway-compatible entry vectorTagsExpressionMutationPromoterAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEntry_SARS-CoV-1-Nucleocapsid
Plasmid#168852PurposeGateway-compatible Entry vectorDepositorInsertSARS-CoV-1-Nucleocapsid (N )
UseGateway-compatible entry vectorTagsExpressionMutationPromoterAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-51b(+)-Caprola_09
Plasmid#194670PurposeProtein production of the split HaloTag based calcium recorder Caprola_09 in bacteriaDepositorInsertCaprola_09
UseTagsHis-tag and Strep-tagExpressionBacterialMutationPromoterT7Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-M.Mus.2
Plasmid#196682PurposeRep/Cap plasmid for the production of M.Mus.2, an AAV capsid with CNS tropism in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVTagsExpressionMutationREQQKLW insert between amino acids 588 and 589 of…Promoterp41Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-CCCAP
Plasmid#136798PurposeMammalian expression of the centrosomal protein CCCAP N-terminally fused to SNAP-tagDepositorInsertSNAP-CCCAP (SDCCAG8 Synthetic, Human)
UseTagsFLAG-tag / His-tagExpressionMammalianMutationPromoterCMV-TetO2Available SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP C1-Eps8 ∆cap
Plasmid#74786Purposemammalian expression of the capping activity mutant Eps8 fused to GFPDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBiT3.1-C_SCAP:1-905
Plasmid#211302PurposeMammalian expression of full-length human SCAP isoform 2. C-terminal HiBiT tag.DepositorInsertSCAP:M1-D905 (SCAP Human)
UseTagsGSSGGSSGVSGWRLFKKISExpressionMammalianMutationisoform 2. V798I natural variant (VAR_012203)PromoterCMVAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only