We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#80592PurposeExpresses GFP with an Csy4 target hairpin inserted immediately following the start codon for Csy4-mediated regulation. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.DepositorInsertGFP
UseAAVExpressionMammalianMutationInserted 30 nt hairpin which is targeted by Csy4 …PromoterCBAAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGFPmAID_htz-1
Plasmid#174214PurposeDonor plasmid for tagging htz-1 with GFP::mAIDDepositorInsertGFP::mAID::htz-1 tagging donor
UseCRISPRExpressionWormAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-nCas9n-P2A-mKate2-pA
Plasmid#109547PurposeMultisite gateway vector for expression of nCas9n with bicistronic expression of mKate2DepositorInsertnCas9n and mKate2
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
1095=Rcd-1r-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159673PurposePlasmid supports Cas9 expression in both males and females, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertRcd-1r-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
TagsT2A-GFPExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJM149
Plasmid#134168PurposeRetroviral plasmid expressing GFP - Nde1DepositorInsertNde1_SSSC E118A R129A E. coli codon optimized (CRISPR/Cas9 hardened) (NDE1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationSSSC E118A R129A, E. coli codon optimized, CRISPR…Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJM147
Plasmid#134167PurposeRetroviral plasmid expressing GFP - Nde1DepositorInsertNde1_SSSC E47A E. coli codon optimized (CRISPR/Cas9 hardened) (NDE1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationSSSC E47A, E. coli codon optimized, CRISPR/Cas9 h…Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
TR-5'UTR-HP-GFP
Plasmid#80594PurposeExpresses GFP from the CBA promoter. Includes a Csy4 target hairpin in the 5'UTR for Csy4-mediated regulation. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.DepositorInsertGFP
UseAAVExpressionMammalianMutationInserted 30 nt hairpin which is targeted by Csy4 …PromoterCBAAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT9753-BEAR-mScarlet-preedited
Plasmid#162994PurposeBEAR control plasmid with split mScarlet and intact 5' splice siteDepositorInsertmScarlet split with an intron between amino acids 110-111
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
CBEd SpG UGI Puro
Plasmid#235045PurposeCytosine base editor d with SpG nicking Cas9 makes C > T editsDepositorInsertCBEd, nCas9
UseCRISPR and LentiviralTagsP2A-PuroRPromoterEF1a coreAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_CTRL_ER-dAPEX-BFP2
Plasmid#236733PurposeDual sgRNA targeting CTRL expressing dAPEX-BFP targeting to ERDepositorInsertNegative CTRL
UseCRISPR and LentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-DEN2
Plasmid#238020Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-TMV
Plasmid#238021Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-A3A-DEN2
Plasmid#238019Purposefor DNA-free cytosine base editing in rice and wheat or other plantsDepositorInsertA3A-nSpCas9(D10A)-UGI
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-COX8 MTS-3xFlag-TALE array-CBE6d-UGI-P2A-mCherry-UTR
Plasmid#235202PurposePlasmids for constructing mitoBEs v2DepositorInsertCOX8 MTS-3xFlag-TALE array-CBE6d-UGI-P2A-mCherry-UTR
ExpressionMammalianAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor
Plasmid#221839PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoforms BFH) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pp-CBBC-Fluc
Plasmid#232920PurposeAllows the Golden Gate (BsmBI) cloning of pegRNA between two Csy4-hairpins in the intron of a CMV-FLUC encoding plasmid (POL II): ipegRNAs must be processed by Csy4 in VLP- producer cells.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only