60,522 results
-
Plasmid#183748PurposeExpresses EGFP-Ki67-mCherryDepositorInsertMKI67 (MKI67 Human)
TagsKi-67 with N-terminal EGFP tag and Ki-67 with C-…ExpressionBacterial and MammalianPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
dsRed-cent2
Plasmid#29523DepositorAvailable SinceMay 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQ-IRES-mCherry
Plasmid#166950PurposeLentiviral plasmid expressing GFP-tagged SFPQ protein with IRES-mCherry from the EF1a promoterDepositorAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-eTLR
Plasmid#214737Purposeencodes the enhanced traffic light reporter (eTLR) flanked by homology arms for integration into the AAVS1 safe harbor locusDepositorInsertAAVS1-eTLR (PPP1R12C Bovine, Rabbit, Synthetic, Chicken, Human, CMV, Anguilla japonica, influenza)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_MAPK1_WT
Plasmid#82145PurposeGateway Donor vector containing MAPK1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP Snail WT
Plasmid#16225DepositorAvailable SinceNov. 30, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SEC61B.N-BSD.P2A.miniIAA7.3xFlag
Plasmid#216250PurposeHDR template to tag endogenous human SEC61B N-terminus with BSD.P2A.miniIAA7.3xFlagDepositorInsertHDR template for human SEC61B (SEC61B HDR template, Human, Synthetic)
UseCRISPR; Hdr templateTagsBSD.P2A.miniIAA7.3xFlagExpressionMammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET42b-BE3
Plasmid#87437PurposeExpresses BE3-NLS with an N-terminal His Tag (His6) for bacterial expressionDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD9-SBP-mCherry
Plasmid#222329PurposeSynchronize the trafficking of CD9 from the ER.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
plx304-PHB-V5
Plasmid#122230PurposeExpresses human PHB attached to a V5 tagDepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
RT3GEPIR
Plasmid#111169PurposeTet-regulated miR-E (miR-30 variant)-based RNAiDepositorInsertmiR-E (miR-30 variant)
UseRetroviralMutationWTPromoterT3GAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28 MBP NAAEF-AMPKa1 (13-476,529-550)-b2(76-272)-g1(24-327)
Plasmid#177850PurposeBacterial Expression of AMPKDepositorInsertAMPK (a1b2g1)
TagsMBPExpressionBacterialAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBMN-2xFKBP-mEGFP-NDP52
Plasmid#110465Purposeretrovirus construct for stable expressing mEGFP tagged NDP52DepositorAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T1_ATG4B_BamHI_NotI
Plasmid#190862PurposePlasmid for the expression and purification of of ATG4B. Internal reference: SMC1392DepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
AFDN_PDZ_1
Plasmid#103938PurposeProtein expression and purification of TRITHORAX PDZ domainDepositorInsertAFDN (AFDN Human)
TagsGSTExpressionBacterialMutationcontains AA983-1110 of AFDNPromotertacAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX-uORF-HA-birA*-N-Ras(wildtype)-IRES-Puro
Plasmid#120563PurposeExpresses HA-birA*-N-Ras wildtype fusion protein in mammalian cells & for virus productionDepositorAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LRRK2_Halo_N_allele
Plasmid#178142PurposeDonor vector for endogenous tagging of human LRRK2 at the N-terminus with halotagInsertHalotag (LRRK2 Human)
UseDonor vectorAvailable SinceDec. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAd/WT1-IRES-nAmCyan
Plasmid#29756DepositorInsertWilms tumor 1 (WT1 Human)
TagsAmCyan, IRES, and Nuclear localization sequenceExpressionMammalianMutationNo mutations; AmCyan is nuclear localized; WT1 an…Available SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCI-HA3-HPS1
Plasmid#133930PurposeExpresses 3xHA-HPS1 construct in mammalian cellsDepositorAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only