We narrowed to 15,000 results for: GRN
-
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgEIF4EBP1
Plasmid#128097PurposeCRISPR gRNA against human EIF4EBP1 (4EBP1) with Cas9 from S. pyogenes and 2A-EGFPDepositorInsertCRISPR sgRNA against human 4EBP1 (EIF4EBP1 Human)
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75237PurposeCRISPR/Cas9 plasmid against human NFATc1DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188765PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterSFFVAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
shERK2a-mlpx-puro
Plasmid#65229Purposeencodes a shRNA against ERK2DepositorInsertshRNA against ERK2 (MAPK1 Human)
ExpressionMammalianAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
PSuperPuroRetro-1660s(hPot1)
Plasmid#11136DepositorInsertRNAi against Human Protection of Telomeres 1 (control) (POT1 Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEasyG1_nat
Plasmid#184911PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SaCas9
Plasmid#102853PurposeA single-chain light-controllable dSaCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (GRIN2B Synthetic, S. aureus, Human)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoter;Available SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gLacZ dCas9-KRAB-T2a-GFP
Plasmid#234883Purposenon-targeting CRISPRi controlDepositorInsertL1HS gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTBL680 CHYRON3 integration construct
Plasmid#126448PurposeTo integrate the CHYRON3 locus at AAVS1 in human cells.DepositorInsertspU6/3xLacO-CHYRON3 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6/3xLacOAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg1dCas9-KRAB-T2a-GFP
Plasmid#234882PurposeL1HS-silencing plasmid (CRISPRi gRNA1)DepositorInsertL1HS-silencing plasmid (CRISPRi gRNA1)
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-Loop2-8A8G
Plasmid#157983PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Loop2-8A8G
Plasmid#157986PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Loop2-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-YY1
Plasmid#154943PurposeKnocking down of human YY1 through shRNA and amiRNA targeting YY1DepositorAvailable SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)
Plasmid#129028Purposeinactivated control (targeted DNA demethylation),expression of dCas9-hudTET1CD-T2A-mCherry and cloning backbone for sgRNADepositorInsertdCas9-hudTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000072254
Plasmid#78161PurposeLuciferase controlDepositorInsertLuciferase
UseRNAiPromoterhU6Available SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only