We narrowed to 14,065 results for: crispr grnas
-
Plasmid#171528PurposePlasmid contains the Cas12k gRNA for mutant library constructionDepositorInsertCas12k gRNA
UseCRISPRPromoterConstitutive promoter J23119Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGTPA
Plasmid#171525PurposePlasmid contains the Cas12k gRNA and transposon donor cassetteDepositorInsertCas12k gRNA, transposon donor cassette
UseCRISPRPromoterConstitutive promoter J23119Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OMKSL-PP
Plasmid#102899PurposeEBNA episome plasmid for U6 promoter-driven expression of 10 gRNAs targeting OCT4, MYC, KLF4, SOX2 and LIN28A promoters. Includes PGK-puro selection cassette.DepositorUseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196084Purpose(Empty Backbone) Inducible CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN441
Plasmid#137873PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F1-GFP
Plasmid#91881PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Promoter Only Target
Plasmid#127669PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2a/Cre
Plasmid#89644PurposeExpresses a Cdkn2a-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKeap1/Cre
Plasmid#89645PurposeExpresses a Keap1-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
1161F
Plasmid#183138PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 3 gRNA targeting D.suzukii bTub,Hr5Ie1-eGFP tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056K
Plasmid#183137PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAK_lentiguide_DR30_Puro
Plasmid#134839PurposeLentiviral expression CasRx guideRNADepositorInsertCasRx guideRNA backbone
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags3XFLAG-Cas9ExpressionMammalianPromoterCBh; U6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only