We narrowed to 15,000 results for: GRN
-
Plasmid#100770PurposeLentiviral expression of shRNA targeting NixDepositorInsertLenti-sh-Nix
UseLentiviralExpressionMammalianPromoterhU6Available SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-HDAC1-shRNA3
Plasmid#90243PurposeLentivirus for expression of shRNA3 against human HDAC1 (Dox-inducible)DepositorInsertHDAC1 (HDAC1 Human)
UseLentiviralAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgTP53(R273)
Plasmid#85561PurposeExpresses sgRNA targeting human TP53 around codon R273DepositorInserttumor protein p53 (TP53 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
D. vulgaris sp2 CRISPR/pACYCDuet-1
Plasmid#81186PurposeExpresses CRISPR array containing 3 copies of Desulfovibrio vulgaris spacer 2 and flanking repeats in E. coliDepositorInsertSynthetic CRISPR array (3 copies of D. vulgaris spacer #2 flanked by repeats)
UseCRISPRTagsNoneExpressionBacterialPromoterT7Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-shTACC3
Plasmid#59355PurposeKnocks down TACC3 in mammalian cells via shRNA and co-expresses GFP.DepositorInsertEGFP
UseRNAiExpressionMammalianAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shKIBRA-A
Plasmid#40888DepositorAvailable SinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shKIBRA-B
Plasmid#40889DepositorAvailable SinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSico-shRaptor
Plasmid#81086Purposeconditional expression of an shRNA targeting murine RaptorDepositorInsertRaptor shRNA (Rptor Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available SinceSept. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1_puro_shNRF2-1
Plasmid#230086PurposeshRNA silencing human NRF2 geneDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7558 pHR (hU6-crB2M-EFS-PuroR-WPRE)
Plasmid#214881PurposeLentiviral vector encoding RfxCas13d targeting B2M guideDepositorInserthU6-crB2M-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro PRMT5-CRISPRi
Plasmid#164637PurposelentiGuide-Puro backbone with cloned target sequence for human PRMT5. The insert is: 5´- CACCGAGCCGCGTGTCCAGCGGGA-3. sgRNA achieves a downregulation of PRMT5 in combination with dCAS9-KRAB-MCP2DepositorInserttarget guide sequence PRMT5 inhibition (PRMT5 Human)
UseCRISPR and Lentiviral; InterferenceExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-goldDn29-dCas9-P2A-GFP
Plasmid#247157PurposeMammalian expression of a human codon optimized engineered goldDn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertgoldDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationM6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503NPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdCas9 (GB1079)
Plasmid#75399PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid part for C-terminal fusionsDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR/shp16 (w98-1)
Plasmid#22258DepositorInsertsh cyclin-dependent kinase inhibitor 2A (CDKN2A Human)
UseGateway Cloning and RNAiAvailable SinceDec. 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
pU6nH1-HD10kb
Plasmid#172657PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 10204-bp deletion on HPRT1 geneDepositorInsertpegRNA-HD10kbA/pegRNA-HD10kbB
UseCRISPRAvailable SinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only