We narrowed to 2,180 results for: PAM
-
Plasmid#48664PurposeBacterial NM repression YFP reporter: protospacer ADepositorInsertNM prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-A
Plasmid#48666PurposeBacterial TD repression YFP reporter: protospacer ADepositorInsertTD prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgSp1
Plasmid#174907PurposeSecond generation sgRNA against Sp1DepositorInsertSpecificity Protein 1 (SP1 Human)
ExpressionMammalianMutationMissense mutation to mutate PAM sequencePromoterEFS-NSAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP
Plasmid#124364Purposeconditional expression of a diphtheria toxin receptor (DTR)–GFP fusion proteinDepositorHas ServiceAAV2InsertDTR-GFP
UseAAVTagsGFPPromoterChicken B-actinAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9/VRQR-sgRNA (BbsI)
Plasmid#129725PurposeExpressing SpCas9/VRQR mutant and sgRNA for target sequence with NGA PAMDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMS13: pTarget(AvCAST)
Plasmid#168146PurposeTarget plasmid containing AvPSP1 and attachement site for AvCAST.DepositorInsertsPAM for AvCAST + AvPSP1
glmS
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJEC581
Plasmid#174369PurposeRFP reporter used to evaluate CRISPRa in bacteria, contains gRNA target sites every 10 bp upstream of the promoter.DepositorInsertRFP with PAM rich sequence upstream promoter
UseSynthetic BiologyExpressionBacterialPromoterJ23117Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGY150
Plasmid#249722PurposepGY150 is a CRISPR adenine base editing vector with the nickase variant of SpCas9-NG (nCas9-NG) and an sgRNA cassette, enabling targeted A-to-G conversions at flexible NG PAM sites in filamentous fungDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGY151
Plasmid#249723PurposepGY151 is a CRISPR cytosine base editing (CBE) vector with the nickase variant of SpCas9-NG (nCas9-NG) and an sgRNA cassette, enabling targeted C-to-T conversions at flexible NG PAM sites in filamentoDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAGK43
Plasmid#222223PurposeEdits NPAS2 Gene.DepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
CSM160
Plasmid#105684PurposePlasmid containing an RFP dropout used to construct randomized PAM libraryDepositorInsertRFP Golden Gate dropout
ExpressionBacterialPromoterBba_R0040 TetR PromoterAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
hJAM-A pcDNA3.1
Plasmid#70073PurposeExpresses human junctional adhesion molecule-A in mammalian cellsDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT03
Plasmid#223375PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT04
Plasmid#223376PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT07
Plasmid#223379PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV eGFP hPGK BSD
Plasmid#188519PurposeBackbone for CRISPR activation (CRISPRa) isogenic PAM testingDepositorTypeEmpty backboneUseLentiviralTagseGFPExpressionMammalianAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT05
Plasmid#223377PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only