We narrowed to 26,128 results for: GFP
-
Plasmid#69134PurposeSleeping Beaquty (SB) vector encoding G418 resistance and GFP from two separate promotersDepositorTypeEmpty backboneUseSleeping beauty transposonExpressionMammalianPromoterU3MSCVAvailable SinceJan. 19, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pCDNA5/FRT_CMV_NES-Kinprola_PKA-mEGFP
Plasmid#233353PurposeCMV driven expression of the PKA activity recorder Kinprola_PKA in mammalian cell lines fused to mEGFPDepositorInsertNES-Kinprola_PKA-mEGFP
TagsNES and mEGFPExpressionMammalianPromoterCMVAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-GFP-iCAM-1
Plasmid#205186PurposeThis vector encodes of a synCAM (iCAM1) and GFPDepositorInsertsynCAM iCAM1 and GFP
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-sfGFP-TET1CD
Plasmid#184439PurposeTET1 catalytic domain fused with sfGFP and scFv against GCN4DepositorInsertscFv-GCN4-sfGFP-TET1CD
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLPCX mito Grx1-roGFP2
Plasmid#64977PurposeMammalian expression of mitochondrial Grx1-roGFP2 (retroviral vector)DepositorInsertGlutaredoxin-1 (GLRX Human)
UseRetroviralTagsroGFP2ExpressionMammalianMutationmitochondrial targeting sequenceAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-(pos36)GFP
Plasmid#62937PurposeExpression of 6xHis-(+36)GFP in bacterial cellsDepositorInsert(pos36)GFP
Tags6xHis tagExpressionBacterialPromoterT7Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
cfSGFP2-anti-AlfaTag nanobody
Plasmid#171818PurposeBacterial expression vector for production of fluorescent anti-AlfaTag nanobodyDepositorInsertcfSGFP2-anti-AlfaTag nanobody
Tags6xHis and SEP tag (6xD)ExpressionBacterialAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGCDNsam-Hnf4a-IRES-GFP
Plasmid#33006DepositorInserthepatic nuclear factor 4 alpha (Hnf4a Mouse)
UseRetroviralAvailable SinceMarch 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-EGFP-WPRE
Plasmid#135428PurposeCan be used to express EGFP. Can also be used to create adeno-associated virus for delivery of the EGFP sequenceDepositorInsertEGFP
UseAAVExpressionMammalianPromoterEF1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONRp5-p2 GFP-NShroom3-iLID
Plasmid#170976PurposeN-terminal component of OptoShroom3 optogenetic tool. Binds to apical junctions. pDONRp5-p2 plasmid.DepositorInsertNShroom3 (Shroom3 Mouse)
UseGateway cloningTagseGFP and iLIDMutationFrom isoform 2, deleted amino acids 1389 - 1805,…Available SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
P3-Lenti-dCas9-Tet1-GFP
Plasmid#190729PurposeLentiviral construct to express spdCas9-Tet1-GFP.DepositorInsertdCas9-tet1
UseCRISPRTagsSV40 NLS and T2A-EGFPExpressionMammalianMutationChanged Pro434 codon from CCG to CCC and Gly468 f…PromoterUbCAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-Hygro
Plasmid#184593PurposeEGFPDepositorInsertEGFP
UseLentiviralPromoterCMVAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IPU-GFP-MYH9
Plasmid#168273PurposeExpresses MYH9 in mammalian cellsDepositorAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRE/VEGF/IRES/EGFP
Plasmid#206211PurposeAn expression vector of VEGF and EGFP under control of TRE promoterDepositorAvailable SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo FlucDM EGFP
Plasmid#90172PurposeEGFP-tagged constructs to monitor the aggregation state of the sensors and the ability of cells to solubilize or degrade the aggregated proteins. FLuc contains double mutationDepositorInsertFLuc EGFP
ExpressionMammalianMutationR188Q, R261Q in FLucAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC034 - LwCas13a-msfGFP-2A-Blast
Plasmid#91924PurposeExpresses active LwCas13a for mammalian RNA targeting with Blasticidin selection markerDepositorInsertLwCas13a
UseCRISPR and LentiviralTagsNLS and msfGFP-NLS-3xHA, P2A, BlasticidinExpressionMammalianPromoterEFSAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC28-LIC-sfGFP-His
Plasmid#165479PurposepET based vector for protein expression in E.coli for targets fused with C-terminal superfolder GFP and His tagDepositorTypeEmpty backboneTagsTEV-GFP-6xHisExpressionBacterialAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
P3-dCas9-Tet1-GFP-Puro
Plasmid#190728PurposeExpression of human spdCas9-Tet1 fusion for targeted DNA methylation in mammalian cell. EGFP-puromycin double marker under an independent CMV promoter. Cloning backbone for spgRNA (BbsI)DepositorInsertdCas9-tet1
UseCRISPRTags3XFLAG and SV40 NLSExpressionMammalianMutationChanged Pro434 codon from CCG to CCC and Gly468 f…PromoterpCAGAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only