We narrowed to 8,648 results for: FIE
-
Plasmid#128589PurposeAAV-mediated expression of ChrimsonR-tdTomato under the Syn promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorHas ServiceAAV8InsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterSynAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDN-D2irTNG4kwh
Plasmid#44722DepositorInsertspCMV-D2i promoter
htetR::NLS::EGFP
UseSynthetic Biology; Expression regulator/reporter;…TagsRabbit β-globin intron II and WPREExpressionMammalianMutationInitiator motif (Inr) displaced relative to pCMV-…PromoterpCMV-D2iAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLPX-rc [ChrimsonR-tdTomato]
Plasmid#128587PurposeAAV-mediated expression of ChrimsonR-tdTomato under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorInsertChrimsonR-tdTomato
UseAAVTagstdTomato (codon diversified version)ExpressionMammalianMutationChrimson K176R mutantPromoterEF1α (1.1 kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBK2047-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223167Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM30-ARC105
Plasmid#133426PurposeHuman ARC105 coding sequence in vector for in vitro transcription and protein expression, with T7 promoter.DepositorInsertPCQAP (MED15 Human)
ExpressionBacterialMutationContains amino acids 5-78 fused to C-terminal of …Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmSTING
Plasmid#208386PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine STING gene.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:IL2_SigP:NLuc
Plasmid#197266PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human IL2 locus (exon 3). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertInterleukin-2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-beta-5 in pcDNAI/Amp
Plasmid#55708PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta5. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertmCer(1-158)-beta5 (GNB5 Aequorea victoria, Human)
TagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro HEK3 CTT ins
Plasmid#171995PurposeDelivers all prime editing nuclease components targeting the HEK3 gene for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertHEK3 CTT insertion pegRNA and CbH-Cas9-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA sham
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceSept. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-v2_SigP:NLuc
Plasmid#197268PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (long isoform only). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-v2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA0482
Plasmid#96968Purposeexpression of methicillin-resistant Staphylococcus aureus orf 0482DepositorInsertMRSA ORF0482
TagsN-ter TEV protease cleavable 6HisExpressionBacterialMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
YFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55762PurposeAn amino-terminal YFP fragment was fused to Ggamma2. When co-expressed with a carboxyl terminal YFP or CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(1-158)-gamma-2 (GNG2 Aequorea victoria, Human)
TagsYFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationYFP (1-158) includes a substitution of Met for Gl…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA2028
Plasmid#97001PurposeExpressing MRSA Asp/Tyr/Phe pyridoxal-50- phosphate-dependent aminotransferaseDepositorInsertAsp/Tyr/Phe pyridoxal-50- phosphate-dependent aminotransferase
TagsN-ter TEV protease cleavable 6HisMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-RNA-pCAG-bpNLS-miCBE-SV40NLS-bGH polyA-pCMV-mCherry-AmpR
Plasmid#248061PurposeExpression vector for expression of miCBE-ωRNA v2 driven by chicken β-actin promoter and mCherry driven by CMV promoter.DepositorInsertpU6-RNA-pCAG-bpNLS-miCBE-SV40NLS-bGH polyA-pCMV-mCherry-AmpR
UseCRISPRTagsflagExpressionMammalianMutationnonePromoterCAG, U6Available SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPgk-mTDGa-BioID2-HA
Plasmid#232030Purposemammalian expression (murine Pgk promoter) of murine TDG fused to BioID2-HADepositorTagsNLSExpressionMammalianMutationPgk1 promoter variantPromoterPgk1 promoterAvailable SinceNov. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hCAII
Plasmid#232480PurposeTetracycline inducible PiggyBac vector expressing human CAII gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHuman carbonic anhydrase II (CA2 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only