We narrowed to 3,503 results for: cgas
-
Plasmid#72628PurposeExpresses two gRNAs targeting the UCA1 promoterDepositorInsertgRNAs toward UCA1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDAS12137_sgRNA-PEAR-GFP-nick(+17)-mCherry
Plasmid#177183Purposeplasmid expressing an sgRNA targeting the PEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the PEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-HNF4α
Plasmid#139305PurposeKnocking down of human HNF4α through shRNA and amiRNA targeting HNF4αDepositorInsertshRNA and amiRNA against HNF4α
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-RRBP1-1
Plasmid#92156PurposeCRISPR guide RNA targeting human RRBP1DepositorInsertRRBP1 sgRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xPP7_SL]
Plasmid#68424PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertINT construct bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
Luc-SIRT1 mutant 3'UTR
Plasmid#20380DepositorAvailable SinceMay 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
shCDK4/6(1)
Plasmid#73554Purposevector encoding both shRNA against CDK4(1) and shRNA against CDK6(1)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-G9A_1
Plasmid#36395DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJ23119-sgRNA
Plasmid#113654PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter J23119 and sgRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 1221
Plasmid#31978DepositorAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330-UFM1 sgRNA2
Plasmid#134634Purposecontains sgRNA targeting human UFM1 for gene knockoutDepositorInsertUFM1 sgRNA2 (UFM1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV/3' Box_(GLuc)_INT
Plasmid#68436PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR-TER+-shLKB1-Hu
Plasmid#61243PurposeEntry clone encoding shRNA to human LKB1DepositorAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
p CIneo-RL-Let7-3xBulgeB-mut
Plasmid#115369PurposeExpression vector to produce humanized Renilla luciferase with three mutated (seed-sequence mutations) partially complementary binding sites for human let-7 miRNA in the 3'UTRDepositorInsertRenilla Luciferase
UseLuciferaseExpressionMammalianPromoterCMVAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTC394
Plasmid#91224Purposeprotoplast vector expressing gRNA24 targeting tomato ANT1 (control without TREX2 expression)DepositorInsertgRNA targeting tomato ANT1
UseCRISPRExpressionPlantAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-C-mCherryTag
Plasmid#218183PurposeTo tag Hevin with mCherry at its C-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.1039
Plasmid#105566Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.643
Plasmid#105565Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shTGFBR3 puro
Plasmid#58696PurposeLentiviral shRNA vector for knockdown of human TGFBR3DepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJMP1104
Plasmid#119248Purposeknockdown pqsC in P. aeruginosaDepositorInsertsgRNA pqsC (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Skil-gRNA2
Plasmid#180371Purposetargeting mouse Skil/SnoN geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1p shDna2
Plasmid#31951DepositorAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pGEX PLCg1(C)-SH2
Plasmid#46469DepositorInsertPLCg1(C)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 656-766PromoterTacAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV/MASC_(GLuc)_INT
Plasmid#68440PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. CMV/ MASC expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 Intergenic control guide 2
Plasmid#193585PurposesgRNA control; induces CAS9 cutting in an intergenic regionDepositorInsertsgRNA control
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkB2 guide 2
Plasmid#193594PurposeNFkB2 knockoutDepositorInsertsgNFkB2 guide 2 (NFKB2 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgGFP-2
Plasmid#74961PurposeCas9 + sgGFP-2 with blasticidin selectionDepositorInsertGFP
UseCRISPRExpressionMammalianAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-mSox10-2
Plasmid#37007DepositorAvailable SinceMay 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU1/Sm/3' Box_(GLuc)_INT
Plasmid#68438PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
BoxB-MS2 adRNA (RAB7A-ACG site)
Plasmid#170155PurposeAAV vector carrying a BoxB-MS2 adRNA targeting the RAB7A transcript for C-U editingDepositorInsertBoxB-RAB7A(ACG)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB3020(gRNA X-2)
Plasmid#73282PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G20-R20
Plasmid#101822PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA2_GAL4UAS-Luciferase reporter
Plasmid#64158PurposePhotoactivatable transcription system. Lentiviral expression of sgRNA2 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA2 for GAL4UAS-Luciferase reporter
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[P4-P6(3xPP7)]
Plasmid#68432PurposeTransient expression in mammalian cells of an "INT" construct_bearing P4_P6 (internally appended with three PP7 stem-loops), targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing P4_P6 (internally appended with three PP7 stem-loops)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-DoxOn-shCUX1-5150
Plasmid#90469PurposeLentiviral vector expressing a doxycycline-inducible shRNA against human CUX1 sequence starting at 5150 of M74099DepositorInsertTGCTGTTGACAGTGAGCGTCAGAGCGATAATACACTATTATAGTGAAGCC
UseLentiviral and RNAiExpressionMammalianAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK158_mCherry-4.1G-deltaCTD-hardened
Plasmid#46360DepositorInsert4.1G (EPB41L2 Human)
TagsmCherryExpressionMammalianMutationDeleted amino acids 886-1005, and modified for si…PromoterCMVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-1
Plasmid#193694PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only