We narrowed to 15,000 results for: GRN
-
Plasmid#22193DepositorInsertsh Mediator of DNA damage checkpoint 1
UseLentiviral and RNAiAvailable SinceDec. 18, 2009AvailabilityAcademic Institutions and Nonprofits only -
pENTR/pTER shEGFP #2 (728-2)
Plasmid#17471PurposeGateway entry vector for EGFPshRNA#2 under H1/TO promoterDepositorInsertEnhanced green fluorescent protein shRNA #2
UseGateway Cloning and RNAiAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGY037 BSMV-gamma-AmCyan
Plasmid#234818PurposeTo express flourescent protein AmCyan from the gamma genome of Barley Stripe Mosaic Virus Vector (T-DNA)DepositorInsertAmCyan
ExpressionPlantAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-9
Plasmid#193668PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.dTomato-miR30n
Plasmid#90334PurposemiR30 based shMir knockdownDepositorInsertsdTomato
na
SFFV
miR30n
UseLentiviralAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair3
Plasmid#98974PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 37bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 3 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9
Plasmid#87917PurposeGateway cloningDepositorInsertsgHTT1, sgGFP2, shCas9
ExpressionMammalianPromoterH1, U6, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25I
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U6
Plasmid#173157PurposeSingle guide RNA cassette under U6 promoterDepositorInsertsgRNA cassette under U6 promoter
ExpressionPlantPromoterAtU6-26Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459-APP-KO
Plasmid#176487PurposeTo knockout APP geneDepositorInsertgRNA sequence
UseCRISPRAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB8792
Plasmid#126910PurposeTemplate for PCR amplification of ADE2 gRNA biobrick for targeting Saccharomyces cerevisiae ADE2 geneDepositorInsertADE2 gRNA
UseSynthetic BiologyAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
SGL40C.EFS.RFP657
Plasmid#69147PurposeAdvanced lentiviral Vector for sgRNA (hU6 Promoter) delivery with RFP657 expression (EFS Promoter)DepositorInsertssgRNA
EFS
tagRFP657
Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgRB1#2
Plasmid#174145PurposeLentiviral vector expressing a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEE390
Plasmid#149280PurposeT-DNA encoding TRV2 with gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only