We narrowed to 2,745 results for: EXO
-
Plasmid#197429PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsGCN4 leucine zipper, LOV2, Zdk1, and mCherryAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-π-EB1_EF1α-EGFP
Plasmid#197430PurposeHomology-directed repair template targeting EF1α-based π-element to MAPRE1 exon 5DepositorInsertEF1α-based π-element with HDR templates flanking MAPRE1 exon 5 insertion site (MAPRE1 Human)
UseCRISPR and Synthetic BiologyTagsEGFP, GCN4 leucine zipper, LOV2, and Zdk1Available SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
hTln1-R1R2
Plasmid#191440PurposeExpresses the human TLN1 R1R2 domains in bacteriaDepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmPAN2-del1047-1063-GSG-dsRNAres_Y
Plasmid#148070PurposeInsect Expression of DmPAN2-del1047-1063-GSG-dsRNAresDepositorInsertDmPAN2-del1047-1063-GSG-dsRNAres (PAN2 Fly)
ExpressionInsectMutationone silent mutation compared the the sequence gei…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsDCP1a-Y36A_P
Plasmid#147218PurposeMammalian Expression of HsDCP1a-Y36ADepositorInsertHsDCP1a-Y36A (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP1a-Y36A_P
Plasmid#147221PurposeMammalian Expression of HsDCP1a-Y36ADepositorInsertHsDCP1a-Y36A (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and T1716G compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del136-152-siRNAres_K
Plasmid#146750PurposeMammalian Expression of HsSmg6-del136-152-siRNAresDepositorInsertHsSmg6-del136-152-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM41P-HsUPF3b-iso2_145-470_K
Plasmid#146754PurposeBacterial Expression of HsUPF3biso2_145-470DepositorInsertHsUPF3biso2_145-470 (UPF3B Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-HsUPF3b-iso2_145-470_K
Plasmid#146759PurposeBacterial Expression of HsUPF3biso2_145-470DepositorInsertHsUPF3biso2_145-470 (UPF3B Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del42-58-del136-152-siRNAres_K
Plasmid#146748PurposeMammalian Expression of HsSmg6-del42-58-del136-152-siRNAresDepositorInsertHsSmg6-del42-58-del136-152-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del817-1238-siRNAres_I
Plasmid#146555PurposeMammalian Expression of HsSmg6-del817-1238-siRNAresDepositorInsertHsSmg6-del817-1238-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg6-del817-1238-siRNAres_I
Plasmid#146564PurposeMammalian Expression of HsSmg6-del817-1238-siRNAresDepositorInsertHsSmg6-del817-1238-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-HsUPF3biso2_I
Plasmid#146568PurposeMammalian Expression of HsUPF3Biso2DepositorInsertHsUPF3Biso2 (UPF3B Human)
ExpressionMammalianMutationone silent mutation T510C compared to the sequenc…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12WT
Plasmid#194167PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 10-12 . Expresses the tau circular RNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT
Tags3X FlagExpressionMammalianAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 7-12WT
Plasmid#194170PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 7,9-12 . Expresses the tau circular RNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertmicrotubule-associated protein tau 7-12 WT
Tags3x FlagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12V337M
Plasmid#194165PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau V337M mutation. Expresses the tau circRNA 12-->10 V337M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
ExpressionMammalianMutationChanged Valine 337 to MethinonineAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-62-SFFV-T2A-PuroR-polyA-R11b
Plasmid#179893PurposeDonor with homologous arms for Rab11b to knock in SFFV-T2A-Puromycin resistance-PolyA cassette (for knock out)DepositorInsertRAB11B, member RAS oncogene family (RAB11B Human)
UseCRISPR; Donor for homologous based knock inExpressionBacterial and MammalianPromoterSFFVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-64-SFFV-T2A-BlaR-polyA-R11b
Plasmid#179895PurposeDonor with homologous arms for Rab11b to knock in SFFV-T2A-Blasticidin resistance-PolyA cassette (for knock out)DepositorInsertRAB11B, member RAS oncogene family (RAB11B Human)
UseCRISPR; Donor for homologous based knock inExpressionBacterial and MammalianPromoterSFFVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Prom1 Del EC2
Plasmid#184025PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 273-287.DepositorInsertProm1 SV8(-Ex19a) Del EC2 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-STC
Plasmid#162490PurposeExpresses partial length Tac (stem region, TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (stem region, TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its stem region, TM…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GABARα6N-HA
Plasmid#128111PurposeExpress HA tagged GABARα6 N terminal domainDepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FKBP12-Gag(HIV)
Plasmid#138476PurposeExpresses FKBP12 fused Gag for packaging FRB-SpCas9 into NanoMEDIC particle.DepositorInsertHIV Gag
TagsFRBP12 and Lynn Myristolation siteExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)
Plasmid#119826PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tagPromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD63-SBP-mCherry
Plasmid#222326PurposeSynchronize the trafficking of CD63 from the ER.DepositorInsertStreptavidin-KDEL and CD63 fused to SBP-mCherry (CD63 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
sFlt1-e15a V5
Plasmid#86045Purposehuman Soluble Flt1 isoform e15a (terminates in exon 15a)DepositorInserthuman soluble Flt1 isoform e15a (FLT1 Human)
Tags6xHis and V5ExpressionMammalianMutationisoform e15a (terminates in exon 15a)PromoterCMVAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shSTING-Hsa
Plasmid#128158PurposeDoxycyclin inducible shRNA knockdown of human STING geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF1-GRM3 WT
Plasmid#31798DepositorAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsUPF3biso2_I
Plasmid#146574PurposeMammalian Expression of HsUPF3biso2DepositorInsertHsUPF3biso2 (UPF3B Human)
ExpressionMammalianMutationone silent mutation T510C compared to the sequenc…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV-hHOXA13
Plasmid#135561PurposeExpress hHOXA13 and EGFP in mammalian cellsDepositorAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
CD44v-HA (pcDNA3)
Plasmid#238417PurposeExpresses CD44, a single-pass transmembrane protein containing variable exons 3 to 10.DepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-BAP1-HA
Plasmid#154020PurposeMammalian Expression of HA-tagged Wild-Type BAP1DepositorAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
155_KRAS in pmiRGlo
Plasmid#78132Purposeluciferase reporter for miRNA activityDepositorInsertKRAS (KRAS Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutation3'UTR containing miRNA binding sitesPromoterPGKAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP(N-glyc)-Tac-TC
Plasmid#162496PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in the N-terminus in mammalian cells, and there is one N-glycosylation site in GFP tag.DepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCOLADuet-1_nsp10 (SARS-CoV-2)
Plasmid#169158PurposeTo express SARS-CoV-2 nsp10 in E. coliDepositorInsertnsp10 (ORF1ab SARS-CoV-2)
TagsMethionineExpressionBacterialMutationCodon optimised for E. coliPromoterT7Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg
Plasmid#73073Purposehuman E2F7 minigene (exons 11,12,13/introns cassette)DepositorInsertE2F7 (E2F7 Human)
ExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterCMVAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_BbsI-gRNA scaffold-EC73-5'-EcoRI-EC73-3'-HDV_pA_pCMV_EGFP-L202S-P2A-mCherry_pA
Plasmid#176461PurposeVector for constructing retron Ec73ncRNA-gRNA chimeric RNA (Ec73 rgRNA), inserting spacer sequence by BbsI digestion and inserting donor sequence by EcoRI digestion. EGFP(L202S)-P2A-mCherry driven by CMVDepositorInsertBbsI-gRNA scaffold-Ec73ncRNA-EcoRI-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only