We narrowed to 27,307 results for: GFP
-
Plasmid#137820Purposeexpression of CD44 proteins in mammalian cellsDepositorAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CaMKII-SomArchon
Plasmid#126942PurposeExpression of SomArchon under CaMKII promoterDepositorInsertSomArchon
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable sinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMP2463
Plasmid#107774PurposeExpression of EGFPDepositorInsertpLacZ-EGFP in pBBR1-mcs5
TagspLacZ-EGFPExpressionBacterialPromoterpLacZAvailable sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Px461-Cas9n-Trp53-sgRNA-alpha
Plasmid#88846PurposeCRISPR KO of Trp53DepositorAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-cofilin WT
Plasmid#78295PurposeMammalian expression of mouse cofilin fused to EGFPDepositorAvailable sinceMay 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTitin
Plasmid#26428DepositorInsertpartial sequence of mouse Titin
UseLentiviralAvailable sinceNov. 18, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
-
p426 25Q GAL
Plasmid#1187DepositorAvailable sinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-C1-alpha2-chimaerin
Plasmid#59316PurposeExpression plasmid for GFP-tagged alpha2-chimaerin (GFP at N-terminus of alpha2-chimaerin)DepositorPublicationInsertalpha2-chimaerin
TagsGFPExpressionMammalianPromoterCMVAvailable sinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-tev-2xTS
Plasmid#117750PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to two tyrosine sulfation (TS) motifs. VHH-2xTS also contains a T7, HA, BAP, tev cleavage site and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialPromoterT7Available sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-GFP-human cGASdeltaN
Plasmid#186880PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal GFP fusion (Adamts1 Human, Synthetic)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-GFP
Plasmid#186845PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal GFP fusion (Adamts1 Human, Synthetic)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-PTEN
Plasmid#50519PurposeThis plasmid contains GFP21, which has a sequence similar to YFP, but emission/excitation similar to GFP.DepositorAvailable sinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL50005
Plasmid#245578PurposeLevel 0 Golden Gate part C-Terminal Tag with overhangs TTCG - GCTTDepositorInsertC-Terminal tag YFP tag (yellow variant of GFP)
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable sinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-11Y
Plasmid#238999PurposeFinal circuit with -Ara: OFF, +Ara: OFF behaviourDepositorInsertCircuit with no sfGFP expression (-Ara: OFF, +Ara: OFF)
UseSynthetic BiologyExpressionBacterialMutationWTAvailable sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
JBL6401
Plasmid#183838PurposesfGFP reporter under the control of WT E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable sinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-Z11
Plasmid#239001PurposeFinal circuit with -Ara: ON, +Ara: ON behaviourDepositorInsertCircuit with sfGFP expression (-Ara: ON, +Ara: ON)
UseSynthetic BiologyExpressionBacterialMutationWTAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJBL7346
Plasmid#217370PurposesfGFP reporter for synthetic transcriptional variant of Pca rhtB ZTP riboswitchDepositorPublicationInsertPca rhtB synthetic transcriptional riboswitch sfGFP reporter
Available sinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by