We narrowed to 15,275 results for: grn
-
Plasmid#231166PurposeT-DNA encoding TRV2 with ipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESSDepositorInsertipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESS
ExpressionPlantPromoterPEBV sub-genomicAvailable sinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-CANX
Plasmid#227279PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of CANX for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting C-terminus of CANX (CANX Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pSpCas9(BB)-2A-Puro-C9orf72
Plasmid#83439PurposeExpresses Cas9 and a gRNA targeting C9orf72DepositorAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
Plasmid#209196PurposeMutagenesis of Cnr1DepositorAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiGuide-Puro-IFITM3g1 (BB15)
Plasmid#139460PurposeLentiviral vector with gRNA targeting IFITM3; includes puromycin selectable markerDepositorInsertIFITM3-targeting sgRNA inserted; resistance gene: puroR (IFITM3 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDP012
Plasmid#101167PurposeE. coli/S. cerevisiae shuttle vector carrying amdS andSpcas9D147Y P411T and expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 and in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available sinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro HEK3 CTT ins
Plasmid#171995PurposeDelivers all prime editing nuclease components targeting the HEK3 gene for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHEK3 CTT insertion pegRNA and CbH-Cas9-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA sham
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable sinceSept. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-loxP-P2A-EGFP-loxP
Plasmid#188774PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterSFFVAvailable sinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBFC0687
Plasmid#186692PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_2xBsaI_NT (Guide Stuffer) gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 tTA SDHB
Plasmid#177977PurposeAll-in-one dox-repressible expression of cDNADepositorInsertSDHB (SDHB Human)
UseLentiviralExpressionMammalianMutationSilent point mutations to SDHB sgRNA targetAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pESR1.1.0-gDNA
Plasmid#112433PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ESR1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertESR1 (ESR1 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9
Plasmid#92113PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdead/inactive SpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-CMV-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188772PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterCMVAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sgempty
Plasmid#159523PurposeExpression of dCas9 driven by lux cassette from Vibrio fischeriDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dcas9 and sgRNA
UseCRISPRPromoterquorum sensing promoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable sinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.643
Plasmid#105565Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorPublicationInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF1-sh3
Plasmid#69042PurposeLentiviral expression of IKZF1 shRNADepositorAvailable sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSUPER-retro-puro-Smad4
Plasmid#89829PurposeKnockdown human Smad4 expression in human mammalian cellsDepositorInsertSmad4 shRNA (SMAD4 Human, Mouse)
UseRetroviralAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by