We narrowed to 41,625 results for: Eras
-
Plasmid#246407PurposeExpresses K682R_K686R_K69R_K709R POLH with an N-terminal NLS~FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682R_K686R_K69R_K709R. Coding sequence has …Available SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLH_ΔGG NEDD8
Plasmid#221860PurposeExpresses FLAG-tagged WT POLH fused to ΔGG NEDD8 in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAG and ΔGG NEDD8ExpressionMammalianMutationCoding sequence has been optimised for expression…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT POLH_ΔGG Ubiquitin
Plasmid#221861PurposeExpresses FLAG-tagged WT POLH fused to ΔGG ubiquitin in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAG and ΔGG UbiquitinExpressionMammalianMutationCoding sequence has been optimised for expression…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_K682A_K709A POLH
Plasmid#221864PurposeExpresses POLH mutated at K682A and K709A with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682A + K709A. Coding sequence has been opti…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_K682A_K686A_K694A_K709A POLH
Plasmid#221865PurposeExpresses POLH mutated at K682A, K686A, K694A and K709A with a FLAG tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsFLAGExpressionMammalianMutationPOLH K682A, K686A, K694A + K709A. Coding sequence…PromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 EXOC3prom SV40
Plasmid#246713PurposeTo investigate the influence of a universal enhancer (SV40) on EXOC3 promoter activity (measured by luciferase expression)DepositorAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10 promEXOC3
Plasmid#205467PurposeLuciferase reporter of promoter activityDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-Off_FLEX_Luc-P2A-H2A-mCherry (JDW 970)
Plasmid#229824PurposeA PiggyBac vector with a cre-dependent dual luciferase / nuclear mCherry reporter. In the presence of cre, this tet-off vector will be ubiquitously expressed in the absence of dox/tetDepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSF_his6_sumo_ZIKV_NS5_MTase
Plasmid#213529PurposeExpresses the MTase domain of NS5 of ZIKVDepositorInsertZIKA virus NS5 methyltransferase domain
TagsHis6-sumoExpressionBacterialMutationMTase domain aa 1-265Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_allW
Plasmid#224252PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_allWDepositorInserthnRNPA1_allW (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationF17W,F25W,F31W,F37W,F43W,Y52W, Y59W, F62W, F69W, …PromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-SET-EMD (N-SET-EMD)
Plasmid#217765PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSET-EMD-EGFP (C-SET-EMD)
Plasmid#217764PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorAvailable SinceJune 12, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-KSR1-CA3 (N-KSR)
Plasmid#217755PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKSR1-CA3-GS-mRFP1 (C-KSR-GS)
Plasmid#217758PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsmRFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKSR1-CA3-GS-EGFP (C-KSR-GS)
Plasmid#217757PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 with GGSSGGGGA linkerPromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
LMPd Amt PHGDH
Plasmid#209409PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertPhgdh shRNA (Phgdh Mouse)
UseRetroviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-806_HA-GD2-28z_CAR_RFP-TFAP4
Plasmid#207493PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-851_HA-GD2-28z_HA-TFAP4
Plasmid#207501PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertHA-TFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only