We narrowed to 15,000 results for: GRN
-
Plasmid#110410PurposeshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2res
Plasmid#106301PurposeExpresses SHMT2DepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationSilent mutations destroy sgRNA targeting sitesAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ANLN
Plasmid#183834PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertANLN homology arms with mNeonGreen-linker (ANLN Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-SID4x-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188901PurposedCas9 with an N-term Sid4x fusion, a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertSID-dCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, P2A-GF…PromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2804 pHR: U6-SpsgTRE3G CMV-PYL1-VPR-IRES-mCherry
Plasmid#84258PurposeExpresses Sp sgTRE3G gRNA with ABA-inducible VPR and mCherry for OR gateDepositorInsertsSp sgTRE3G
PYL1-VPR
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
Plasmid#84260PurposeExpresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulationDepositorInsertsSp sgSV40
PYL1-KRAB
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ENL)
Plasmid#69212PurposeLentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; MLL-ENL,(t[11;19])DepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTC362
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-CACNG3
Plasmid#140590PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA CACNG3
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1.530
Plasmid#205441PurposeLevel 1 Position 1 pUC19 vector with sgRNA and GmR. Used for homologous recombination with Cas12a editing vector pC1.509. sgRNA targets pC1.509 for removal.DepositorInsertRepB gRNA
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN10-gCAG
Plasmid#114384PurposepPN10 with gRNA for spCRISPR-Cas9 targeted to CAG repeat, PAM: CAGDepositorInsertgCAG
UseCRISPRAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK473
Plasmid#114715PurposesgRNA for LGN's N-terminal locusDepositorInsertLGN sgRNA
Available SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT062d
Plasmid#107911PurposeW2m.2-4 plasmid. Contains H1-TetR-sgRNA B and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertH1-TetR-sgRNA B
ExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT062e
Plasmid#107910PurposeW2m.2-3 plasmid. Contains U6-LacI-sgRNA A and is ppart of the CAMERA2m system for cellular recording in mammalian cellsDepositorInsertU6-LacI-sgRNA A
ExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBHM2644
Plasmid#229528PurposeCarries AID* tag, empty sgRNA, and NATR markerDepositorInsertAID* - empty sgRNA - NATR
Tags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only