We narrowed to 14,805 results for: mal.3
-
Plasmid#193473PurposeAcceptor plasmid for 3 plasmid recombination assayDepositorInsertKp03_attB
ExpressionMammalianPromoterEf1aAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEH381 VSV-G MS2 HA
Plasmid#168223PurposeMammalian expression of vesicular stomatitis virus glycoprotein fused to the MS2 dimer and C-terminal HA tagDepositorInsertVSV-G
TagsHA and MS2 dimerExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9 gateway compatible
Plasmid#128322PurposedCas9 C-terminal gateway cloning vectorDepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
S10A mutant of H3S10ph biosensor
Plasmid#120810PurposeFRET biosensor. Eliminating the H3 Serine 10 phosphorylation site in H3S10ph biosensor to abolish the detection capabilityDepositorInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa) S10A-YFP
ExpressionMammalianMutationSerine 10 is mutated to Alanine, and Threonine 3,…PromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-155-5p
Plasmid#103265PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-155-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-155-5p target (MIR155 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M5-U6-sgRNA-M7-U6-sgRNA-M9-IRES-CFP
Plasmid#114729Purpose3 sgRNAs targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M5, sgRNA M7, sgRNA M9
UseCRISPRExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLN472 (FuGW-G8p-STE-1Pe)
Plasmid#105190PurposeModule 3 - GAL4 synthetic promoter (with eight binding sites) drives the expression of STE transcripts containing miR1-Bs(Pe)DepositorInsertG8p-STE-1Pe
UseLentiviral and Synthetic BiologyTagsHA tagExpressionMammalianAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-N3FLAG-MYB-FL
Plasmid#105609Purposetransient express full length MYB with 3*FLAG tag at N terminal in HEK 293T cellsDepositorAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm/Cre
Plasmid#89643PurposeExpresses an Atm-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmad4/Cre
Plasmid#89651PurposeExpresses a Smad4-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82703PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
373_MLH1 in pmiRGlo
Plasmid#78133Purposeluciferase reporter for miRNA activityDepositorInsertMLH1 (MLH1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutation3'UTR containing miRNA binding sitesPromoterPGKAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-ET
Plasmid#72542Purposeexpresses FLAG tagged human BRD4 ET domain (608-699 aa)DepositorAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGK:HygroR-CMV:mTagBFP2-A_UTR
Plasmid#68479PurposeLentivirus expressing mTagBFP2 with UTR sensor cassette and hygromycin resistanceDepositorInsertsHygromycin Resistance
mTagBFP2-A_UTR
UseLentiviralExpressionMammalianMutationshRNA sensor cassette "A" added to 3…PromoterCMV and pGKAvailable SinceNov. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
VZV ORF 37(gH)
Plasmid#64081Purposeeukaryotic expression plasmid for VZV glycoprotein HDepositorInsertVZV glycoprotein H
ExpressionMammalianPromoterCMV IE with intronAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
VZV ORF 60 (gL)
Plasmid#64082Purposeeukaryotic expression plasmid for VZV glycoprotein LDepositorInsertVZV glycoprotein L
ExpressionMammalianPromoterCMV IE with intronAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-RGS7
Plasmid#55760PurposeAn amino-terminal mCerulean fragment was fused to RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertmCer(1-158)-RGS7 (RGS7 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationRGS7 was amplified via PCR, which added an N-term…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDNA CrkII Y221F
Plasmid#50732Purposemammalian expression of CrkII Y221F mutantDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-ChroME2s-ST-P2A-NLS-mRuby3
Plasmid#170177PurposeCation channelrhodopsin ChroME2s targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME2s-ST-P2A-NLS-mRuby3
UseAAVExpressionMammalianAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only