We narrowed to 10,500 results for: fus
-
Plasmid#50733PurposeProduces lentivirus expressing human EWSR1 wild type with FLAG tag at its N-terminus and Myc tag at its C-terminus by co-transfection with psPAX2 and pMD2GDepositorAvailable SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pBRα-β flap (831-1057)
Plasmid#53734PurposeExpression of alpha NTD fused via three alanines to E. coli RNAP subunit beta, aa 831-1057 (β-flap). Can be cut with Not1 and BamHI to replace β-flap with a moiety of interest.DepositorInsertalpha NTD-Beta flap fusion
ExpressionBacterialPromoterlpp/lacUV5 (tandem promoter)Available SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGWB404
Plasmid#74798PurposeGateway cloning compatible binary vector for C-terminal fusion with sGFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDicAID_nCas9-PmCDA_NptII_Della
Plasmid#91694PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1 with sgRNA targeting SlDellaDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9PromoterPcUbiAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-TrxRFP1
Plasmid#98996Purposemammalian expression of a biosensor to monitor thioredoxin redox dynamicsDepositorInserthuman thioredoxin 1, GS-rich linker, fused with a redox-sensitive RFP
TagsHis-tagExpressionMammalianPromoterCMVAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pET Flag TEV LIC cloning vector (1L)
Plasmid#29662DepositorTypeEmpty backboneTagsFlag and TEV cleavage siteExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC3-hGli3
Plasmid#65435PurposeExpresses human Gli3 protein in mammalian cellsDepositorAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGWB555
Plasmid#74885PurposeGateway cloning compatible binary vector for N-terminal fusion with mRFP (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP GFP-SNAP29
Plasmid#45923DepositorAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCas9-CtIP
Plasmid#109403PurposeExpresses Cas9 fusion to human CtIP proteinDepositorInsertCtIP (RBBP8 Human)
Mutationfull length CtIPAvailable SinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP GFP-Stx7
Plasmid#45921DepositorAvailable SinceJuly 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMK391 (mAID-BSD)
Plasmid#121192PurposeC-terminal taggingDepositorInsertmAID-BSD
UseCRISPRAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-MacroGreen
Plasmid#160665PurposeExpresses GFP fusion of a multisite mutant of the Af1521 proteinDepositorInsertAf1521 modified synthetic construct eGFP fusion
TagseGFP and hexahistidine_TEV recognitionExpressionBacterialPromoterLacIAvailable SinceJuly 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS500 EF1alpha-GFPcre
Plasmid#11920DepositorAvailable SinceSept. 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
WNV strain-NY99 NS2B-NS3 protease fusion with non cleavable linker with mutation K to A to reduce autoproteolysis
Plasmid#228660PurposeBacterial expression of the fusion of the NS2B-NS3 protease from West Nile virus with an H163A - catalytically inactive mutation for xxxxxDepositorInsertWest Nile portion of NS2B protease fused to NS3
TagsHis-Twin Strep-TevExpressionBacterialMutationH163A - catalytically inactive/West Nile Virus NS…Available SinceFeb. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIVEX-SNAP-GFP
Plasmid#46846PurposeSNAP-GFP fusionDepositorInsertSNAP-GFP fusion
UseIn vitro expressionAvailable SinceAug. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGWB535
Plasmid#74873PurposeGateway cloning compatible binary vector for C-terminal fusion with LUC (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceOct. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGWB511
Plasmid#74853PurposeGateway cloning compatible binary vector for C-terminal fusion with FLAG (CaMV35S promoter).DepositorTypeEmpty backboneExpressionPlantPromoterCaMV35SAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-FerH-ffLuc2-eGFP
Plasmid#71393PurposeLentiviral vector of luciferase-eGFP fusion gene driven by FerH promoterDepositorInsertFerH-ffLuc2-eGFP
UseLentiviralExpressionMammalianPromoterFerHAvailable SinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pHR-UCOE-SFFV-Zim3-dCas9-P2A-BFP
Plasmid#188767PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pS-sg:GFP
Plasmid#196296Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding sgRNA:GFP fusion in place of viral NSsDepositorInsertFull length TSWV S antigenome encoding sgRNA:GFP fusion in place of viral NSs
UseCRISPRExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGWB433
Plasmid#74824PurposeGateway cloning compatible binary vector for C-terminal fusion with GUS (no promoter).DepositorTypeEmpty backboneExpressionPlantAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pP{ELAV-GeneSwitch}
Plasmid#83957PurposeExpresses conditional RU486-dependent GAL4 protein under control of the elav promotorDepositorInsertExpressionInsectPromoterelavAvailable SinceDec. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFS_0453_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)_T7term_ARRAY2_FaqI
Plasmid#117006PurposeExpresses E. coli codon-optimized FsRT-Cas1-Cas2 under ptetA promoter, encodes FsCRISPR array 2, compatible with SENECA acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATG-2460
Plasmid#108713PurposeEF1-CBR2opt-T2A-copGFP (construct used for lentiviral transduction)DepositorInsertCBR2opt-copGFP fusion
UseLentiviralTagsCBR2opt fused to copGFPMutationPromega used directed evolution to create CBR (Cl…Promoterelongation factor-1Available SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Mocr TEV LIC cloning vector (1O)
Plasmid#29658DepositorTypeEmpty backboneTags6xHis, Mocr, and TEV cleavage siteExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCDH_Str-KDEL_neomycin
Plasmid#65307PurposeLuminal ER hook only (RUSH system)DepositorInsertStreptavidin fused to a signal sequence at 5' end and to a KDEL motif at 3' end
UseLentiviralTagsKDEL motif and Signal SequencePromoterCMVAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS505 EF1alpha-EGFPcre*
Plasmid#11955DepositorAvailable SinceSept. 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGWB402-omega
Plasmid#74797PurposeGateway cloning compatible binary vector for expression of gene by 2xCaMV35S enhancer and omega sequence.DepositorTypeEmpty backboneExpressionPlantPromoter2xCaMV35S enhancer and omegaAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHIV-H2B-eGFP
Plasmid#91776PurposeExpresses H2B protein tagged with eGFPDepositorInsertHuman Histone H2B / eGFP (H2BC11 Human)
UseLentiviralTagseGFPExpressionMammalianPromoterEF1aAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pThy1-Flpbow3
Plasmid#45181DepositorInsertpThy1-Flpbow3
UseLinearized for transgenic mouse injectionPromoterThy1Available SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGWB553
Plasmid#74883PurposeGateway cloning compatible binary vector for C-terminal fusion with mRFP (no promoter).DepositorTypeEmpty backboneExpressionPlantPromoterNo PromoterAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET30a-His6-LOXCAT
Plasmid#140084PurposeFusion of A. viridans lactate oxidase (LOX) and E. coli catalase (CAT) that converts lactate into pyruvate without producing H2O2.DepositorInsertA fusion of lactate oxidase from A. viridans and catalase from E. coli
TagsHis6ExpressionBacterialPromoterT7Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
hRad51(A89E)–Cas9(D10A)
Plasmid#125563PurposeExpresses the Rad51(A89E)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYES2-Ub-M-GFP
Plasmid#11952DepositorInsertUb-M-GFP
ExpressionYeastMutationUbiquitin fused to N-terminus of GFP. Methionine …Available SinceMay 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6-HA-AML1-ETO
Plasmid#12508DepositorInsertHA-AML1-ETO (RUNX1T1 Human)
ExpressionMammalianAvailable SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only