We narrowed to 7,309 results for: aav
-
Plasmid#36070DepositorInsertalpha-synuclein S87A/S129A (SNCA Human)
UseAAVExpressionMammalianMutationS87A/S129APromoterCMVAvailable SinceSept. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-CsChR-GFP
Plasmid#58841PurposeAAV expression of CsChR-GFP under the Syn promoterDepositorInsertCsChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAav-MCS-PQS2-3xHA
Plasmid#84917PurposerAAV-based template for genome engineering of protein C-termini containing PQS2 and 3xHA tags and a selection cassetteDepositorInsertLOX-PGK-NEO-LOX
UseAAVTagsPQS2 3xHAPromotermPGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2A-ΔC-S227A
Plasmid#200560PurposeSecreted mouse CES2A S227A mutant driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2A S227A mutant delta C-terminal (Ces2a Mouse)
UseAAVTagsFlagPromoterCMV promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1495 - pAAV CaMKII SERCaMP_ASARTDL
Plasmid#192602PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_04-mEGFP_WRPE-SV40
Plasmid#194688PurposehSyn1 driven expression of the calcium recorder Caprola_04 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_04-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-eGFP-RAB11
Plasmid#203731PurposeAAV vector plasmid expressing human RAB11 fused to eGFP under the human synapsin (SYN) promoterDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DIO-GRAB_CRF1.0
Plasmid#208662PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0 in a cre-dependent mannerDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) sensor GRAB_CRF1.0
UseAAVPromoterEFSAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEO-CaMKII-EGFP
Plasmid#177018PurposeFor expression of EGFP in a single-floxed, excisable open reading frame (cre-off), under control of the CaMKIIa promoterDepositorInsertEGFP
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-alphaCaMKII-E2-Crimson-3XNLS-pA
Plasmid#183803PurposeAAV vector to express nuclear localized E2-Crimson from CaMKIIa promoterDepositorInsertE2-Crimson-NLS
UseAAVTagsNLSAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-PDGFRb559-562del-HA
Plasmid#204351PurposeExpresses a mutant PDGFRb gene (559-562 deletion). Used for DNA delivery using Adeno-associated Virus.DepositorInsertPlatelet derived growth factor receptor beta (PDGFRB) (PDGFRB Human)
UseAAVTagsHAMutation559-562 deletionAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synp-F-H2B-GCaMP6f
Plasmid#102994PurposeExpresses histone fused GCaMP6f under the synapsin promoterDepositorInsertH2B-GCaMP6f
UseAAVExpressionMammalianPromoterhuman synapsin I promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-CB2gRNA-CBh-mCherry
Plasmid#91948PurposeExpression of gRNA for mouse CB2 cannabinoid receptor and mCherryDepositorInsertmCherry
UseAAVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pEF1a-DIO-tTAc
Plasmid#172126PurposeExpression of InteinC-tTAC in Cre recombinase positive cellsDepositorInsertInteinC-tTAc
UseAAVPromoterCaMKIIAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc CB6PI Gpluc7XmiR-122T
Plasmid#35647DepositorInsert7 bulged miR-122 target sites
UseAAVPromoterCBAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.A184V
Plasmid#106190PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterCAGAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1
Plasmid#124870PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV TBG FFluc miR122sponge
Plasmid#35657DepositorInsertmiR-122 sponge
UseAAVPromoterTBGAvailable SinceJuly 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-integrin alpha9-V5
Plasmid#203729PurposeAAV vector plasmid expressing human integrin subunit alpha 9 (ITGA9) fused to V5-tag under the human synapsin (SYN) promoterDepositorInsertITGA9 (ITGA9 Human)
UseAAVTagsV5-tagExpressionMammalianPromoterHuman synapsin promoterAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP306-pAAV-EFS-MCS3-pA
Plasmid#113682PurposeEFS driven Multi Cloning Site-3.DepositorInsertN/A
UseAAVPromoterCytomegalo Virus(CMV)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-splitTVA800
Plasmid#59330PurposeExpresses splitTVA800DepositorInsertsplitTVA800
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FlpE-bGHpA
Plasmid#50364PurposeCan be used to generate AAV virus that will express FlpE recombinse gene in neurons from the synapsin promoterDepositorInsertFlpE recombinase gene
UseAAVPromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
LITE1.0_pAAV_hSyn_TALE(Grm2)-NLS-CIB1_2A_GFP_WPRE_bGHpA
Plasmid#47453PurposeepiLITE / LITE1.0 TALE-CIB1. CIB1 binds to blue-light-activated CRY2PHR. Particular TALE targeted to Grm2 promoter. Synapsin promoter for neuronal expression.DepositorInsertTALE (N136,Grm2,C63)-cib1
UseAAV; TaleTagsHAExpressionMammalianPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-rev-g2-2A-Venus
Plasmid#71410PurposeThis plasmid is pAAV-panpromoter-flex-rev-gamma2F77-2A-Venus. Confers zolpidem sensitivity on zolpidem-insensitive neurons.DepositorInsertsUseAAV and Cre/LoxExpressionMammalianPromotermouse hdc gene promoter, works as a pan neuronal …Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13D/sgKras/Cre
Plasmid#99857PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Pcdh15_mini_V7-CD2
Plasmid#199186PurposeAn AAV plasmid designed to facilitate the expression of mini-PCDH15 in the inner ear of a mouse.DepositorInsertmmPcdh15_mini_V7-CD2
UseAAVExpressionMammalianMutationEC4, EC5, EC6, EC9, EC10 are deleted from msPCDH1…Available SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Pcdh15_mini_V8-CD2
Plasmid#199187PurposeAn AAV plasmid designed to facilitate the expression of mini-PCDH15 in the inner ear of a mouse.DepositorInsertmmPcdh15_mini_V8-CD2
UseAAVMutationEC5, EC6, EC8, EC9, EC10 are deleted from msPCDH1…Available SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FDIO-SYP-HRP
Plasmid#117187PurposePlasmid name in publication: pAAV-FDIO-SV-HRP. Peroxidase reporter for multiplexed electron microscopy labelingDepositorInsertSYP-HRP
UseAAV; Flp/frtExpressionMammalianPromoterEF1aAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12S/sgKras/Cre
Plasmid#99853PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRger3-TS-EYFP
Plasmid#127241PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCamKIIaAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-DIO-mAPX
Plasmid#79908PurposeAdeno-associated virus plasmid, Cre-dependent FLEX switch, mAPXDepositorInsertmAPX
UseAAV and Cre/LoxExpressionMammalianAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E1.1-NRSE-RFP
Plasmid#22929DepositorInsertE1.1 binding site from Scardigli et al. 2003, with neuron-restrictive silencing element, with minimal CMV
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAav-MDM2-PQS2-3xHA
Plasmid#84886PurposerAAV-based template for genome engineering of the MDM2 protein C-terminus containing PQS2 and 3xHA tags and a selection cassetteDepositorUseAAVTagsPQS2 3xHAPromoternoAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg1
Plasmid#124856PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMK233 (AAVS1 CMV-AtAFB2)
Plasmid#140537PurposeAAVS1 CMV-AtAFB2DepositorInsertCMV-AtAFB2
ExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Mac-GFP
Plasmid#58853PurposeAAV-mediated expression of Mac-GFP under the Syn promoterDepositorInsertMac-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1alpha-soCoChR-GFP
Plasmid#107709PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. EF1alpha promoterDepositorInsertsoCoChR-GFP
UseAAVTagsEGFP and KA2ExpressionMammalianPromoterEF1alphaAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-GFP
Plasmid#122098PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS5-ChR2-YFP
Plasmid#178725PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODAL-matMYC
Plasmid#115639PurposeFor targeted integration and inducible expression of human NODAL (with an N-terminal MYC tag on the mature peptide) using doxycyclineDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-Synapsin-mTurquoise2-C1-WPRE
Plasmid#159953Purposeuntargeted markerDepositorInsertmTurquoise2-C1
UseAAVExpressionMammalianMutationsyntheticPromoterhSyn1Available SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Lyn-Y-GECO1
Plasmid#58200PurposeExpress the membrane targeted Y-GECO1 in neuronsDepositorInsertY-GECO1.0
UseAAVPromoterhSynAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgKcnab2
Plasmid#192795PurposeEncodes SaCas9 and an sgRNA targeting mouse Kcnab2DepositorInsertsgKcnab2
UseAAV and CRISPRPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP
Plasmid#89061PurposeAAV-gRNA targeting the murine Ldlr geneDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP223-AAV-EFS-GFP-pA
Plasmid#62913PurposeAAV vector backbone designed to express GFP from a EFS promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromotershort form of Elongation Factor1α (EFS)Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV syn Arrestin-TEVp-V5
Plasmid#173118PurposeExpresses arrestin receiver construct in neuronsDepositorInsertArrestin-TEVp-V5
UseAAVPromoterSynapsinAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only