We narrowed to 7,646 results for: cat.1
-
Plasmid#245966PurposeExpression of cof with one of 4 cys mutated to ala. Incorporates into cofilactin rodsDepositorAvailable SinceOct. 22, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
huCof null + rat cof shRNA
Plasmid#245960PurposeSilencing of endogenous cofilin in rat/mouse cells with replacement by an inactive human cofilin expressed with a cofilin promoter (control for plasmid listed above)DepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutation_1-5, Y82F, KK95,96QQPromoterMCP for cofilin and pol III for shRNAAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
huCof C39S-mRFP
Plasmid#245967PurposeExpression of cof with one of 4 cys mutated to ser. Incorporates into cofilactin rodsDepositorAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
MCP-huCof K22Q + rat cof shRNA
Plasmid#245959PurposeSilencing of endogenous cofilin in rat/mouse cells with replacement by human cofilin K22Q expressed with a cofilin promoterDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationK22QPromoterMCP for cofilin and pol III for shRNAAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof C139A-mRFP
Plasmid#245968PurposeExpression of cof with one of 4 cys mutated to ala. Incorporates into cofilactin rodsDepositorAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
huCofilin S3E SSR
Plasmid#245940PurposeExpresses human cofilin with mutation S3E that behaves like inactive phosphocofilin but can be dominant negative against phosphataseDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationS3E; silent mutations (NTs 67 to 75) in which TCT…PromoterCMVAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
huCof K95Q-mRFP
Plasmid#245974PurposeExpression of cofilin with mutation in one actin binding domainDepositorAvailable SinceOct. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET30a-ManC-NahK-ET64
Plasmid#234664PurposeExpression an ELP-tagged fusion enzyme of PfManC and NahKDepositorInsertsGDP-Man pyrophosphorylase
N-acetylhexosamine 1-kinase
TagsELPExpressionBacterialAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT6)
Plasmid#236203Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR1 (1-378)
Plasmid#236264PurposeBacterial expression of bovine arrestin-1 (1-378) E379StopDepositorInsertarrestin-1 (SAG Bovine)
ExpressionBacterialMutation(1-378) E379Stop, inserted GGT codon after starti…PromoterlacAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR1
Plasmid#236262PurposeBacterial expression of bovine arrestin-1 with inserted GGT codon after starting ATGDepositorInsertarrestin-1 (SAG Bovine)
ExpressionBacterialMutationinserted GGT codon after starting ATGPromoterlacAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR1 R175E
Plasmid#236263PurposeBacterial expression of bovine arrestin-1 R175E with inserted GGT codon after starting ATGDepositorInsertarrestin-1 (SAG Bovine)
ExpressionBacterialMutationR175E, inserted GGT codon after starting ATGPromoterlacAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circNUDC_1
Plasmid#215232PurposeSupression of shcircNUDC(5,RI,6)_1 expressionDepositorInsertcircNUDC shRNA 1 (NUDC Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEY141
Plasmid#223488Purposetrp-4(intron 1) fluorescent neural reporter driving nuclear mCyOFP1 expression (refer to NeuroPAL paper for expression)DepositorInserttrp-4(intron 1) (trp-4 Nematode)
ExpressionWormAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-GMIP(trunc N1)
Plasmid#221278PurposeExpression of GMIP N-terminal truncation 1 (16-84) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc C1)
Plasmid#221273PurposeExpression of IRSp53 C-terminal truncation 1 (247-355) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-IRSp53(trunc N1)
Plasmid#221272PurposeExpression of IRSp53 N-terminal truncation 1 (257-375) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-183)
Plasmid#221255PurposeExpression of TRIF truncation 9 (184-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-GMIP(trunc C2)
Plasmid#221280PurposeExpression of GMIP C-terminal truncation 2 (1-44) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-123)
Plasmid#221252PurposeExpression of TRIF truncation 6 (124-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-143)
Plasmid#221253PurposeExpression of TRIF truncation 7 (144-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-163)
Plasmid#221254PurposeExpression of TRIF truncation 8 (164-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-43)
Plasmid#221248PurposeExpression of TRIF truncation 2 (44-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-63)
Plasmid#221249PurposeExpression of TRIF truncation 3 (64-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-83)
Plasmid#221250PurposeExpression of TRIF truncation 4 (84-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TRIF(trunc 1-103)
Plasmid#221251PurposeExpression of TRIF truncation 5 (104-222) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJET-LB-geneticin
Plasmid#213468PurposeVector to amplify the LB-geneticin fragment for transformation into TSI locus 1DepositorInsertLeft border of the TSI locus 1-split fragment of geneticin cassette
ExpressionBacterialAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp-exon minimal CMV pCDNA5
Plasmid#212084PurposeLR vector for integration of Sap30bp-exon_siResist into N2a FRT rtTA3 expression cellsDepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
LifeAct-mNeonGreen -IRES- Talin head-SpyTag003
Plasmid#210024PurposeExpression of LifeAct-mNeonGreen and Talin head(1-433)-SpyTag003 in mammalian cellsDepositorInsertLifeAct-mNeonGreen co-expressed with Talin head(1-433)-SpyTag003
ExpressionMammalianMutationEncephalomyocarditis virus internal ribosome entr…PromoterCMVAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBZS-YP_009701874
Plasmid#198378PurposeExpress YP_009701874 in bacterial cells.DepositorInsertYP_009701874 (CVA-1_543R )
ExpressionBacterialAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBZS-YP_009665506
Plasmid#198376PurposeExpress YP_009665506 in bacterial cells.DepositorInsertYP_009665506 (NYs-1_727R )
ExpressionBacterialAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBZS-YP_009665369
Plasmid#198375PurposeExpress YP_009665369 in bacterial cells.DepositorInsertYP_009665369 (NYs-1_421L )
ExpressionBacterialAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1-1248_H
Plasmid#146507PurposeMammalian Expression of HsTNRC6A_1-1248DepositorInsertHsTNRC6A_1-1248 (TNRC6A Human)
ExpressionMammalianMutation254-1962 truncated version of the sequence given …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-2
Plasmid#193665PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2ABFP-W
Plasmid#163170PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2AmCherry-W
Plasmid#163172PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-Cdc45 (delta 154–164)
Plasmid#126879PurposeExpresses crystallisation construct of human Cdc45 in bacteriaDepositorInsertHuman Cdc45 (CDC45 Human)
TagsNo tagExpressionBacterialMutationdeletion amino acid 154-164PromoterT7 promoterAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB62 - pL0_STR (pro + 5U)
Plasmid#123186PurposeGolden Gate (MoClo; PRO + 5U) compatible STR1 promoter from Catharanthus roseusDepositorInsertCatharanthus roseus STR1 promoter and 5'UTR
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sitesAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1delta
Plasmid#124150PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
mdm1_pJet1.2
Plasmid#121977Purposefor generating mdm1 riboprobes for WISH in zebrafishDepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -