173,291 results
-
Plasmid#35027DepositorAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pGGAselect
Plasmid#195714PurposepGGAselect is a cloning vector for Golden Gate Assembly using BsaI, BsmBI, and BbsI Type IIS restriction enzymes.DepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pXPR_502_sgCD4
Plasmid#158704PurposeCD4 CRISPRa controlDepositorInsertCD4 (CD4 Human)
UseLentiviralAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 PRDM16
Plasmid#15503DepositorInsertPRDM16 (Prdm16 Mouse)
ExpressionMammalianAvailable SinceDec. 14, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCold CL7-Cas12a
Plasmid#124891Purposeobtaining full Cas12a RNPDepositorInsertCas12a
ExpressionBacterialAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAC-LYC
Plasmid#53270PurposeContains 3 genes (crtE, crtI, and crtB) of the carotenoid pathway gene cluster of Erwinia herbicola (Pantoea agglomerans) Eho10 and thereby produces lycopene in Escherichia coliDepositorInsertcrtE, crtI, crtB
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RB1-shRNA63
Plasmid#25641Purpose3rd generation lentiviral vectorDepositorAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
Flag-HA-BAP1
Plasmid#22539DepositorAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
EF1a_CDX2_P2A_Hygro_Barcode
Plasmid#120432PurposeBarcoded lentiviral vector to express CDX2 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ALK5 wt
Plasmid#80876Purposemammalian expression of ALK5 WTDepositorAvailable SinceAug. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-puroeGFP
Plasmid#177922PurposeConstitutively expresses eGFP with puromycin selectionDepositorInserteGFP
ExpressionMammalianPromoterCMVAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCryptDel4.8
Plasmid#141293PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.DepositorInsertsRelB
gRNA targetting pMUT2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterNative promoter from pMUT2 relB/relE operon and P…Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-Cas9-NLS-6xHis
Plasmid#62933PurposeExpression of Cas9-NLS-6xHis in bacterial cellsDepositorInsertCas9-NLS-6xHis
Tags6xHis tag and NLSExpressionBacterialPromoterT7Available SinceMay 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-nLuc
Plasmid#199755PurposeControl construct of elongation reporter to quantify elongation of YFPDepositorInsertNanoluc
ExpressionYeastPromoterTetO7Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-B2M-miniGag
Plasmid#228957PurposeminiEDV production plasmid. Expresses the miniGag (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag
ExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.cTNT.iCre
Plasmid#69916PurposeUsed to package AAV9:cTNT.iCre, which specifically transduce cardiomyocytes and express Cre recombinase. Only works in vivo.DepositorHas ServiceAAV9Insertimproved cre (iCre) recombinase and tdTomato
UseAAVTagsThe iCre coding frame and tdTomato coding frame i…PromoterChicken cardiac troponin TAvailable SinceDec. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-HA
Plasmid#49851PurposeEncodes human connexin 43 with a C-terminal HA epitope fusion tagDepositorInsertConnexin 43 (GJA1 Human)
TagsHAExpressionMammalianMutationContains several wobble mutations to confer resis…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -