We narrowed to 88,262 results for: MAL
-
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT1AR gRNA (5-HT1A Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA2 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT7R gRNA (5-HT7 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf nhsl1b-mNeongreen
Plasmid#233883PurposemNeongreen tagged form of zebrafish nhsl1b. For in vitro transcription (SP6) or expression through CMV.DepositorInsertnhsl1b (nhsl1b Zebrafish)
UseIn vitro synthesis of mrnaTagsmNeongreenExpressionMammalianMutationPromoterAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-P2AT2A-EGFP-BRD4-NUT
Plasmid#238281PurposeFor overexpression of mCherry-P2AT2A-EGFP-BRD4-NUTDepositorInsertmCherry-P2AT2A-EGFP-BRD4-NUT
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
mscv_EGFP-IRES-NUP98-KDM5A-KS-FtoG
Plasmid#238292PurposeFor overexpression of EGFP-IRES-NUP98-KDM5A-KS-FtoGDepositorInsertEGFP-IRES-NUP98-KDM5A-KS-FtoG
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-P2AT2A-GFP-NUP98-DDX10-KS-FtoG
Plasmid#238286PurposeFor overexpression of mCherry-P2AT2A-GFP-NUP98-DDX10-KS-FtoGDepositorInsertmCherry-P2AT2A-GFP-NUP98-DDX10-KS-FtoG
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-mCherry-P2A-T2A-nanobody-KS-FtoA
Plasmid#238288PurposeFor integration of mCherry-P2A-T2A-nanobody-KS-FtoADepositorInsertmCherry-P2A-T2A-nanobody-KS-FtoA
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-P2AT2A-EGFP-BRD4-NUT-KS-FtoG
Plasmid#238283PurposeFor overexpression of mCherry-P2AT2A-EGFP-BRD4-NUT-KS-FtoGDepositorInsertmCherry-P2AT2A-EGFP-BRD4-NUT-KS-FtoG
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-P2AT2A-EGFP-BRD4-NUT-KS
Plasmid#238282PurposeFor overexpression of mCherry-P2AT2A-EGFP-BRD4-NUT-KSDepositorInsertmCherry-P2AT2A-EGFP-BRD4-NUT-KS
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-P2AT2A-GFP-NUP98-DDX10
Plasmid#238284PurposeFor overexpression of mCherry-P2AT2A-GFP-NUP98-DDX10DepositorInsertmCherry-P2AT2A-GFP-NUP98-DDX10
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry-P2AT2A-GFP-NUP98-DDX10-KS
Plasmid#238285PurposeFor overexpression of mCherry-P2AT2A-GFP-NUP98-DDX10-KSDepositorInsertmCherry-P2AT2A-GFP-NUP98-DDX10-KS
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
mscv_EGFP-IRES-NUP98-KDM5A-KS-FtoA
Plasmid#238291PurposeFor overexpression of EGFP-IRES-NUP98-KDM5A-KS-FtoADepositorInsertEGFP-IRES-NUP98-KDM5A-KS-FtoA
UseTagsExpressionMammalianMutationPromoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmBorealin-OLLAS
Plasmid#237439PurposeExpresses mouse Borealin tagged with OLLAS at C-term; made for in vitro transcription (T7 promoter)DepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bm iPGM-HiBiT
Plasmid#218483PurposeBacterially expressed iPGM-HiBiT for Ni-NTA purificationDepositorInsertBm-iPGM-C-HiBIT-Thrombin-6XHis
UseTagsHiBiT Tag and His-tag with thrombin siteExpressionBacterialMutationPromoterT7Available SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only