We narrowed to 7,853 results for: 11
-
Plasmid#113120PurposeDonor plasmid for knock-in T2A-H2B-eGFP to the c-terminal of mouse Pdgfra coding sequenceDepositorInsertPdgfra donor region including homology arms and T2A-H2B-eGFP (Pdgfra Mouse, Synthetic)
UseSynthetic BiologyAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACYCDuet_WTDHFR_WTTS
Plasmid#91226Purposebacterial co-expression of folA (DHFR) and thyA(TS) with a barcode within the noncoding region between the genesDepositorInsertsfolA
thyA
Tags6xHisExpressionBacterialPromoterT7Available SinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGinB-8X(GGS)-dCas9-FLAG-NLS
Plasmid#81205PurposeCMV promoter driving expression of GinB catalytic domain fused with linker to dCas9 in the order shown. Has a FLAG and NLS tag on the c-terminusDepositorInsertpGinB-8X(GGS)-dCas9-FLAG-NLS
ExpressionMammalianPromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-intron
Plasmid#177804PurposeAn intron is inserted into the DsRed gene with a nuclear transfer signal and a 3xFlag tag. The intron can be digested with EcoRV and any pre-miRNA can be inserted.DepositorInsertintron
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBN1
Plasmid#86710PurposeC. elegans injection markerDepositorInsertPlmn-1::mCherry::his-58::pie-1 3'UTR
ExpressionWormAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSP2
Plasmid#26282DepositorInsertMSP2
Tags6-HisExpressionBacterialMutationsynthetic gene of dimer of deletion mutant (1-43)…Available SinceApril 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRK5 mFz8CRD-IgG
Plasmid#16689DepositorAvailable SinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMRX-INU-TEX264 LIR4A-FLAG
Plasmid#128259PurposeExpresses TEX264 LIR4A in mammalian cellsDepositorInsertTEX264 LIR4A (TEX264 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationChanged FEEL (aa 273-276) to alaninesPromoterCMVAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha2
Plasmid#165859PurposeAlpha2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-V96 ELP
Plasmid#67853PurposeGFP Fluorescent Elastin-like Polypeptide(VPGVG) with 96 repeats containing Valine guest residuesDepositorInsertGFP fused to ELP (VPGVG) repeated 96 times
TagsGFP fused to N-terminal of ELPExpressionMammalianPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xControlgRNA
Plasmid#224583PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFosill-3
Plasmid#89697Purposeto make Fosmids that can be converted into Illumina sequencable librariesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
RhoC FLARE.sc mCer, mVenus - CA
Plasmid#65424PurposeRhoC CA biosensor single chain; mCerulean-tagged ROCK-RBD, mVenus-tagged RhoC Q63LDepositorInsertRBD, mCerulean, mVenus, RhoC
ExpressionBacterial, Insect, and Mamm…MutationT153M in mVenus, Q63L in RhoCAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
RhoC FLARE.sc mCer, mVenus - DN
Plasmid#65423PurposeRhoC DN biosensor single chain; mCerulean-tagged ROCK-RBD, mVenus-tagged RhoC T19NDepositorInsertRBD, mCerulean, mVenus, RhoC
ExpressionBacterial, Insect, and Mamm…MutationT153M in mVenus, T19N in RhoCAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFBD-ESCRT 0
Plasmid#21499DepositorInsertpFastBac Dual-His/MBP/Hrs-GST/STAM1 (STAM Human, Mouse)
TagsGST and His-MBPExpressionInsectMutationnoneAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pFosill-2
Plasmid#89696Purposeto make Fosmids that can be converted into Illumina sequencable librariesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSG424 Smad2 (Gal4-Smad2)
Plasmid#14932DepositorAvailable SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNAS1B split mCherry N-link/link-C
Plasmid#61965PurposeNegative control duet plasmid for split mCherry assembly assay (i.e., neither half of mCherry is fused to another peptide or protein)DepositorInsertsN-mCherry-link
link-C-mCherry
ExpressionBacterialPromoterPBAD and PLtetOAvailable SinceFeb. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTAJAK-71 (pESC-NatMXsyn-USER)
Plasmid#78232PurposeEmpty vector, for the insertion of gRNA expression cassettes into the vector.DepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1272
Plasmid#44486DepositorInsertMinimal Mos1, MCS
UseMultiple cloning site vectorAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR9/9*
Plasmid#177805PurposeThe pre-miR-9/9* sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-9/9*
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
3539 pMIG Bax
Plasmid#8788DepositorAvailable SinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
pPLtetO-ClpX
Plasmid#89657PurposePlasmid for titrating synthesis of ClpX with doxycyclineDepositorInsertclpX
UseSynthetic BiologyAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas_5+7_gfp
Plasmid#60595Purposeencodes a reversed Int7 gene flanked by the attB/P sites of Int5, as well as a reversed GFP (GFPmut33) gene flanked by the attB/P sites of Int7.DepositorInsertCas_5+7_gfp
ExpressionBacterialAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIntegrase_10
Plasmid#60581Purposeplasmid contains the integrase gene under the control of the arabinose-inducible promoter, PbadDepositorInsertIntegrase_10
ExpressionBacterialMutationCodon optimized for E.coliPromoterpBADAvailable SinceMarch 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-R4-uAb
Plasmid#101801PurposeBacterial cell expression of the beta-galactosidase-specific ubiquibody, R4-uAbDepositorInsertR4-uAb
Tags6xHis and FlagExpressionBacterialPromoterT7Available SinceNov. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR124
Plasmid#177806PurposeThe pre-miR-124 sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-124
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSC236
Plasmid#216368PurposexhNup155-Nb2i (+2Cys) Nanobody productionDepositorInsertxhNup155-Nb2i (+2Cys)
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSC235
Plasmid#216372PurposexhNup155-Nb3i (+2Cys) Nanobody productionDepositorInsertxhNup155-Nb3i (+2Cys)
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSC227
Plasmid#216351PurposexhNup35-Nb1t (+3Cys) Nanobody productionDepositorInsertxhNup35-Nb1t (+3Cys)
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-I
Plasmid#53439PurposeT7-dependent expression of the type-I agrB and agrD genes of S. aureus RN4220DepositorInsertagrBD locus
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationnonePromoterT7-lacAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMLS791
Plasmid#188889PurposeTargeting vector for insertion into 5' miniMos Arm; carries floxed Cbr-unc-119 marker, Phsp16.41::Cre and Pmyo-2::2xNLS::cyOFPDepositorInsertfloxed Cbr-unc-119 marker, Phsp16.41::Cre and Pmyo-2::2xNLS::cyOFP
ExpressionWormMutationC. elegans codom optimization and intron additionAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
hisSUMO-ZFP57
Plasmid#102716PurposeExpress DNA binding domain of human Zinc finger protein 57 in E. coliDepositorAvailable SinceNov. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-hRabin8 L196A
Plasmid#26727DepositorAvailable SinceDec. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pReporter_2
Plasmid#60563PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_2
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
645 pCS2-etv2
Plasmid#49005PurposeMammalian Expression vector, In-situ probe template and in vitro transcription vector for zebrafish Etv2DepositorInsertets variant gene 2 (etsrp Zebrafish)
UseInvitro transcription, riboprobe templateExpressionMammalianAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMSC130
Plasmid#216364PurposexhNup98-Nb3i Nanobody productionDepositorInsertxhNup98-Nb3i
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-FB-E25TAG
Plasmid#176545PurposeExpresses IgG affinity protein FB with a TAG stop codon at E25 positionDepositorInsertIgG affinity protein
TagsHis tagExpressionBacterialMutationchange glutamic acid 25 to amber stop codonPromoterT5Available SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT206/Sept7shRNA
Plasmid#38299DepositorAvailable SinceNov. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
FabF (KASII) pet28 N-terminal His Tag
Plasmid#75017PurposeExpresses the ketosynthase FabF/KASII from the E. coli fatty acid synthaseDepositorAvailable SinceMay 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBSc + MShab
Plasmid#16146DepositorInsertMus musculus potassium voltage gated channel (Kcnb1 Mouse, Fly)
UseXenopus oocyte expressionMutationN/AAvailable SinceJan. 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAG25-L-IFP-F[1] (clon 3)
Plasmid#52899PurposePlasmid template for PCR of cassettes for HR, used to introduce IFP F[1] fragments 3’ to the ORF of the genes to study. Plasmid confers ampicillin resistance to DH5α.DepositorInsertL-IFP-F[1]
UseVector for homologous recombinationPromoterTEF promoterAvailable SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAG32-L-IFP-F[2] (clon 3)
Plasmid#52900PurposePlasmid template for PCR of cassettes for HR, used to introduce IFP F[2] fragments 3’ to the ORF of the genes to study. Plasmid confers ampicillin resistance to DH5α.DepositorInsertL-IFP-F[2]
UseVector for homologous recombinationPromoterTEF promoterAvailable SinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CB7.CI.PM20D1-flag.WPRE.rBG
Plasmid#132682PurposeAAV plasmid encoding mouse PM20D1 with C-terminal flag tagDepositorInsertPeptidase M20 domain containing 1 (Pm20d1 Mouse)
UseAAVTags6xHIS and FlagPromoterChicken b-actinAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miRNT
Plasmid#177808PurposeA nontargeting miRNA based on the pre-miR- 30a structure (Qiu et al., 2008) has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-NT
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
3XFlag-pLPC
Plasmid#73560Purposevector encoding 3 Flag tagsDepositorInsert3X-Flag
UseRetroviralTags3X-FLAGExpressionMammalianPromoterCMVAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNLRP11major.MYC
Plasmid#131196PurposeMammalian expression of human NLRP11 188SDepositorAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTP443
Plasmid#216361PurposexNup98-Nb1t (+1Cys) Nanobody productionDepositorInsertxNup98-Nb1t (+1Cys)
UseAffinity Reagent/ AntibodyTags14xHis-NEDD8ExpressionBacterialAvailable SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJFRC210-10XUAS-FRT>STOP>FRT-myr::smGFP-OLLAS
Plasmid#63170PurposeGAL4-responsive UAS “flp-On” spaghetti monster GFP-OLLAS reporterDepositorInsert"spaghetti monster GFP-OLLAS"
TagsN-myristoylationExpressionInsectAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only