We narrowed to 15,279 results for: grn
-
Plasmid#139452PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide1
Plasmid#118169PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118163PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118161PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide2
Plasmid#118170PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-neo
Plasmid#65231Purposeencodes a shRNA against ERK2DepositorAvailable sinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Px330-EGFP-LRRK2-CRISPR/Cas9
Plasmid#180437PurposePlasmid to express Cas9 from S.pyogenesand CRISPR gRNA to introduce LRRK2-G2019S mutation in human cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG-HF1
Plasmid#218164PurposeThis plasmid harbors the base editor eSCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-efficiency and high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ECT2
Plasmid#183835PurposeRepair template for the N-terminal tagging of Ect2 with mNeonGreen in human cells using CRISPR/Cas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertECT2 homology arms with mNeonGreen-linker (ECT2 Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-mir144 EF1Alpha-puro-T2A-BFP
Plasmid#164791PurposeExpress miR-144 under the U6 promoter in mammalian cellsDepositorInsertsUseLentiviralExpressionMammalianPromoterEF1Alpha and U6Available sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP1
Plasmid#184556PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαWT-IRES-EGFP
Plasmid#183456PurposeReplacement of endogenous rat PKA-RIIα subunits with wild-type RIIαDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mR2-CAAX
Plasmid#183871PurposeRepair template for the stable expression of a mRuby2-CAAX fusion in human cells using CRISPR/Cas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAAVS1 homology arms with CMV-driven mRuby2-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmRuby2-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSin-EF2-DMD53-GFP
Plasmid#138353PurposeExpressing a GFP reporter cassette, whose GFP reading frame is disrupted by insertion of partial DMD exon 53 sequencesDepositorInsertDMD exon 53 partial sequence to disrupt GFP reading frame (DMD Human)
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterEF2Available sinceNov. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
Plasmid#140205PurposeProof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsmCherry
sgRNA E1
UseCRISPR and Synthetic Biology; Proof-of-concept te…MutationG174DPromoterPelcA and U3Available sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB_p300_core-dCas9-EGFP_hygro
Plasmid#226431PurposePiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection markerDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsp300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, P2A-EGFP, and p300 coreExpressionMammalianPromoterDox inducible minimal CMV and UbC PromoterAvailable sinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC
Plasmid#140203PurposeFungal vector to express an LbCas12a crRNA array targeted to Pelca, to be contransformed with pCRI009 containing PelcA-mCherry in a dLbCas12a-VPR strain as proof-of-concept of CRISPRa.DepositorInsertcrRNA array elcA
UseCRISPR and Synthetic BiologyPromoterPgpdAAvailable sinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSc1-puro
Plasmid#80438PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell, and also confers resistance to puromycinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertssp Cas9 gRNA
eGFP
Puromycin resistance
UseCRISPRExpressionMammalianPromoterCMV, U6, and hPGKAvailable sinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by