We narrowed to 31,392 results for: LIS
-
Plasmid#104052PurposeAn AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the CAG promoterDepositorHas ServiceAAV PHP.V1InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP
Plasmid#104055PurposeAn AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV2, and AAV5InsertEYFP
UseAAVPromoterCAGAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP
Plasmid#117383PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFPDepositorHas ServiceAAV1InsertEYFP
UseAAVExpressionMammalianPromoterTREAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-2xNLS-mTurquoise2
Plasmid#118025PurposeAn AAV genome that expresses nuclear localized mTurquoise2 from the hSyn1 promoterDepositorInsert2xNLS-mTurquoise2
UseAAVTagsNLSPromoterhSyn1Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-2xNLS-mTurquoise2
Plasmid#104053PurposeAn AAV genome encoding expression of the nuclear localized fluorescent protein mTurquoise2 from the GFAP promoterDepositorInsert2xNLS-mTurquoise2
UseAAVTagsNLSPromoterGFAPAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
0_T7-mScarlet3
Plasmid#225927PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 (control)DepositorInsertmScarlet3
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVExpressionMammalianPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-GNL
Plasmid#204499PurposeExpresses Glis1, Nanog and lin28a by tet-on promoter in mammalian cellsDepositorInsertGlis1 (Glis1 Mouse)
ExpressionMammalianAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLGB36
Plasmid#135621PurposeSuicide vector for allelic replacement in Bacteroides species including B. fragilis strain 638R, erythromycin selection and aTC-inducible ss-Bfe3 counterselectionDepositorInsertbfe3
UseBacteroides suicide vector with inducible counter…Tagssignal sequence for periplasmic targetingPromoterBacteroides promoter regualted by TetR transcript…Available SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJ207 Delta-cpc-KanR
Plasmid#51468PurposeDeletes the cpc operon in Synechocystis and confers kanamycin resistanceDepositorInsertReplacing the cpc operon with kanamycin resistance
UseSynthetic BiologyPromoterSynechocystis endogenous cpc-operon promoterAvailable SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH862-CEN-slowmaxRLuc/minCFLuc
Plasmid#115371PurposeExpresses translation initiation-controlled Renilla luciferase and translation elongation-controlled firefly luciferaseDepositorInsertsFirefly Luciferase (codon minimised)
Gcn4 5'-UTR + Renilla luciferase (codon optimised)
ExpressionYeastMutationAll codons have been changed for the most favoura…PromoterADH1 and TDH3Available SinceJune 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
10_T7-SP-CD8tm-mScarlet3
Plasmid#225937PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with a signal peptide and the CD8 transmembrane domainDepositorInsertSP-CD8tm-mScarlet3
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
11_T7-SP-mScarlet3-GPI
Plasmid#229806PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with a signal peptide and a GPI attachment siteDepositorInsertSP-mScarlet3-GPI
UseIn vitro transcriptionMutationT7 promoterAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
MtPT4-p3
Plasmid#160003PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the MtPT4 promoter for visualisation of arbuscular mycorrhizal colonisation in Medicago truncatula roots.DepositorInsertsDsRed (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterArabidopsis thaliana Ubiquitin 10 Promoter (AtUb1…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
NbBCP1b-p3
Plasmid#160002PurposeMultigene construct containing the betalain pigment biosynthetic genes under the control of the NbBCP1b promoter for visualisation of arbuscular mycorrhizal colonisation in Nicotiana benthamiana rootsDepositorInsertsBar (reverse orientation)
DODAα1
CYP76AD1
cDOPA5GT
ExpressionPlantPromoterAgrobacterium tumefaciens Nopaline synthase Promo…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET15-ZmPYK
Plasmid#220230PurposeInducible expression of Zymomonas mobilis pyruvate kinaseDepositorTags6xHis-TEVExpressionBacterialPromoterT7Available SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only