We narrowed to 14,068 results for: crispr grnas
-
Plasmid#107144Purposecloning of a sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pYC1640
Plasmid#158719PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using zeocin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYC2085
Plasmid#158721PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using hygromycin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3'UTR-Tetra-com-vector
Plasmid#132553PurposeExpresses spCas9 and sgRNA scaffold with com aptamer replacing the TetraloopDepositorInsertsCas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMLS134
Plasmid#73714PurposeSapTrap destination vector for building sgRNA expression vectors.DepositorInsertpU6::sgRNA
UseCRISPRExpressionWormMutationSapI insertion sitePromoterC. elegans U6 snRNA pol III promoterAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMZ283
Plasmid#52224PurposeExpression of sgRNA precursor with CspCI placeholder for target cloning (see comments).DepositorInsertrrk1-sgRNA
UseCRISPRExpressionYeastPromoterrrk1Available SinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMLS256
Plasmid#73715PurposeSapTrap destination vector for building combined sgRNA expression + repair template vectorsDepositorInsertpU6::sgRNA
UseCRISPRExpressionWormMutationSapI insertion sitePromoterC. elegans U6 snRNA pol III promoterAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC77
Plasmid#62338PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
DD-Cas9 with filler sequence and Venus (EDCPV)
Plasmid#90085PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNADepositorInsertCas9
UseCRISPR and LentiviralTagsDestabilized Domain and FlagExpressionMammalianPromoterEFSAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas-CmR(+)
Plasmid#113633PurposeChloramphenicol resistant derivative of pCas plasmidDepositorInsertChloramphenicol resistance gene
UseCRISPRPromoterPcatAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMJ114
Plasmid#85995PurposeOne-guide Perturb-seq vector backbone; modified bovine U6 promoter; original constant regionDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified bovine U6-2Available SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ117
Plasmid#85997PurposeOne-guide Perturb-seq vector backbone; modified human U6 promoter; constant region 3DepositorInsertsEGFP-NT2_cr3
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified human U6Available SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ179
Plasmid#85996PurposeOne-guide Perturb-seq vector backbone; modified mouse U6 promoter; constant region 2DepositorInsertsEGFP-NT2_cr2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified mouse U6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57-white[coffee]
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedMutationA GC-to-AA mutation that creates a G589E missense…Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLP17_Lenti α-syn
Plasmid#239419PurposeLentiviral plasmid for SpCas9-based CRISPR KO of mouse α-synDepositorInsertmouse a-synuclein sgRNA (Snca Mouse)
UseLentiviralAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7501 pHR (hU6-crNT-EFS-PuroR-WPRE)
Plasmid#214876PurposeLentiviral vector encoding RfxCas13d nontargeting control guideDepositorInserthU6-crNT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only