We narrowed to 13,974 results for: CRISPR-Cas9
-
Plasmid#159747PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
GA04
Plasmid#248860PurposeRetroviral vector encoding cas9-BFP-suntag of the modified casdrop systemDepositorInsertModified casdrop component 1
UseRetroviralAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGmCherry-gRNA
Plasmid#87110PurposegRNA cloning vector with CAGmCherryDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBh-T7-SpG-P2A-mTagBFP2(RAS3583)
Plasmid#223110PurposepCBh Human expression plasmid for SpG with with C-term BPNLS-P2A-mTagBFP2DepositorInserthuman codon optimized nuclease SpG-P2A-mTagBFP2
UseCRISPRTagsBPNLS-3xFLAG-P2A-mTagBFP2ExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 T2 CRIPR in pX330
Plasmid#72833PurposeCRISPR/Cas to target the AAVS1 locus in human cellsDepositorInsertCas9 and gRNA for targeting the AAVS1 locus in human cells
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCE27
Plasmid#174405PurposeC. auris LEUpOUT NAT marker gRNA expression construct. Use with pCE35 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE41
Plasmid#174433PurposeC. auris LEUpOUT HYG marker gRNA expression construct. Use with pCE38 CAS9 expression construct.DepositorInsertHYG 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterial and YeastAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL11023
Plasmid#117542PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + SpCas9-h (no stop codon)(pICSL90005) + YFP (pICSL50005)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S_OMEGA(pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PRKRA
Plasmid#106109PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting PRKRADepositorInsertgRNA targeting PRKRA (PRKRA Human)
UseCRISPRAvailable SinceFeb. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJK413
Plasmid#155372PurposedCas9 oscillator v1 (dCRv1) + [dCas9 + PA4-mVenus] (sgRNAs flip of 412)DepositorInsertsdCas9 (bacteria)
PA4-mVenus
dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK429
Plasmid#155376PurposePphlF_A4NT in dCRv1, 1x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A4NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0009
Plasmid#117545PurposeLevel 1 Golden Gate Cassette: Cas9-K855A expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + SpCas9-KA (no stop codon)(pEPOR0SP0015) + YFP (pICSL50005)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0002
Plasmid#117543PurposeLevel 1 Golden Gate Cassette: Cas9 expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + SpCas9-p (no stop codon)(pEPOR0SP0009) + YFP (pICSL50005)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJK430
Plasmid#155377PurposePphlF_A2NT in dCRv1, 2x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A2NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pMJ920
Plasmid#42234DepositorInsertCas9
UseCRISPRTagsGFP, HA epitope, and NLS (nuclear localization si…ExpressionMammalianMutationcodon-optimized synthetic DNA sequencePromoterCMVAvailable SinceMarch 1, 2013AvailabilityAcademic Institutions and Nonprofits only