We narrowed to 23,602 results for: crispr
-
Plasmid#193780PurposeTricistronic expression of Cas9-mApple-BSD in mammalian cellsDepositorInsertmApple
UseLentiviralExpressionMammalianPromoterIn frame with Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-Cas9-T2A-mCherry
Plasmid#135012PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianPromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC
Plasmid#140198PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a(D156R)-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivated, D156R for improved activ…PromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-RZ-Cas12j2
Plasmid#189784PurposeGolden Gate entry vector to clone the 3rd Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUBC-EBFP2
Plasmid#212314PurposeLentiviral backbone with EBFP2 reporterDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4F2-mCherry
Plasmid#73421PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4F2.DepositorInsertPromoter 4F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJSC270 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant
Plasmid#101217PurposeBacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variantDepositorInsertSpCas9 variant K848A/K1003A/R1060A/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK848A, K1003A, R1060A, N497A, R661A, Q695A and Q9…PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver3.0
Plasmid#176508PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver3.0
Cas12f-GE ver3.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
AA008
Plasmid#216003PurposeFragmid fragment: (Cas protein) preferred over wildtype Cas12aDepositorHas ServiceCloning Grade DNAInsertCas12a_v1.1 [EnAs]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-mitf
Plasmid#69801PurposeUsed to make mitf knockout porcine cell lineDepositorInsertsmitf-sgRNA
SpCas9
ExpressionMammalianPromoterChicken Beta-Actin and U6Available SinceDec. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xHA-LMNB1
Plasmid#207778PurposeDonor template for Blast-2A-3xHA insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xHA Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEJS1005-Lenti-mammalian c.o.AcrIIA5-FLAG-NLS-HygR
Plasmid#136514PurposeExpresses type II-A anti-CRISPR protein AcrIIA5 in mammalian cells in a lentiviral vectorDepositorInsertCodon-optimized AcrIIA5
UseLentiviralTagsFLAG/NLSExpressionMammalianPromoterSFFVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CLTC
Plasmid#227313PurposeDonor template for mStayGold insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold Tag (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b-HEPN
Plasmid#89901PurposeBacterial expression for bzCas13b and crRNA with both HEPN domains mutated. New spacers can be cloned by digesting with BsaI.DepositorInsertCas13b
ExpressionBacterialMutationR116A/H121A/R1177A/H1182APromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only